Jacqueline Houtman on Science and Fiction

Jacqueline Houtman is here, once again, to talk to us about the similarities and differences between science and writing for middle graders! Take it away Jacqueline!
What do you do with a PhD in Medical Microbiology and Immunology?
Write novels for children, of course!

I came to writing middle grade novels from what some would call an unusual background. I spent most of my life thinking I was going to be a scientist. I went to school for many years and spent a lot of time in the lab in anticipation of a career in science. I earned a PhD and then switched over to freelance science writing. I wrote for scientific journals, magazines, and nonprofits. Then an educational publisher asked me to write some short fiction pieces with science content. It was so much fun to use humor and dialogue. And I could control the actions of the characters and make stuff up. That got me hooked on writing fiction.

There are a couple of things that I learned in my scientific career that have come in useful in my fiction. I can’t tell you how many science seminars I attended that started with the speaker putting up a slide of the gene they sequenced. The screen looked like this:

GTTAACCCTAATGGGGTACCATTCGATGTCGTAATCGATCCGGTTAGCT

Only completely filled up with all those letters.

The speaker may feel the need to show how much work he or she did (although these days, sequencing a gene is a lot less time-consuming). It doesn’t do much for the speaker, though, and it was usually a signal for me to start doodling in my notebook. A better seminar would start with an explanation of why they did the work, and how it fits into what we already know or what is still unknown. Sure, show me some sequences, but only if they have a context and a purpose in the story you are trying to tell me.

Eddy shines a light

The main character from Jacqueline's debut middle grade book has stopped by for a chat today!



Tell us a little about yourself.

My name is Eddy Thomas.

Is Eddy short for Edison?

I will not answer that question.

What do you like to do in your free time?

I like to build things out of stuff people throw out. You would not believe the useful items people discard. Sometimes they are not even broken. I pick them up off of the curb so they do not go into the landfill. Sometimes I fix them, or I take them apart and use the parts for other things. For example, I made a sort of alarm clock using the clock from a coffee maker that you can program to make your coffee in the morning so it is ready for you.

There are two kinds of coffee beans. Coffea arabica is generally considered to be of higher quality. Coffea canephorais also called robusta and is easier to cultivate.

What else?

I also have a collection of DVDs of science fiction and fantasy movies. I do not really like the stories because they are not real, but I like to figure out how they do the special effects. Sometimes you can find this out from the extra discs they include. The DVDs of The Lord of the Rings (Three movies directed by Peter Jackson and released in 2001, 2002, and 2003) include an especially extensive collection of features about special effects. I thought it was very interesting to see the different ways they made the hobbits look small. Many of the techniques did not even use computers. For example, forced perspective is an optical illusion that makes things closer to you seem bigger and things farther away seem smaller.

What’s your favorite food?

Meet Jacqueline Houtman and Eddy

Today Jacqueline Houtman has graciously offered to chat with me about EDDY, writing, and science! Check it out:


Eddy knows a lot of random facts. Are these things you already knew? Or did you research each fact specifically to make it fit the scene?
Some of them I knew already and if they fit the scene I would use them. Otherwise I just cruised the Internet for each fact, trying subjects that would fit until I found something fun. The Internet is a wonderful thing.

Similarly, EDDY is centered around science and inventions. What was your research process like for all of this? Did you write the book based on what you learned as a scientist? Or did you have to do a lot of research?
My training was in the biomedical sciences. Most of the biology came from things I knew already, although sometimes I had to dig a little to come up with exactly what I needed. Eddy knows a lot more than I do about electronics, computers, chemistry, and physics. Luckily, my husband is an expert, so I often went to him for ideas. He also read over the manuscript to make sure I got it right.

Why did you decided to write for Middle Graders rather than another age group?