Jacqueline Houtman is here, once again, to talk to us about the similarities and differences between science and writing for middle graders! Take it away Jacqueline!
What do you do with a PhD in Medical Microbiology and Immunology?
Write novels for children, of course!
There are a couple of things that I learned in my scientific career that have come in useful in my fiction. I can’t tell you how many science seminars I attended that started with the speaker putting up a slide of the gene they sequenced. The screen looked like this:
GTTAACCCTAATGGGGTACCATTCGATGTC
Only completely filled up with all those letters.
The speaker may feel the need to show how much work he or she did (although these days, sequencing a gene is a lot less time-consuming). It doesn’t do much for the speaker, though, and it was usually a signal for me to start doodling in my notebook. A better seminar would start with an explanation of why they did the work, and how it fits into what we already know or what is still unknown. Sure, show me some sequences, but only if they have a context and a purpose in the story you are trying to tell me.
Similarly, in fiction, it is a good idea to know as much as you can about your characters and setting, but it’s not necessary to tell us the color of the walls in every room in the house, unless or course it’s important to the plot. Just because you know what the main character ate at each meal, there’s no need to tell us what was in every bite. Knowing all these facts makes your book deeper and richer, but if you tell us every one of these facts we will throw the book against the butternut-colored walls.
When I was coaching scientists in writing, one of the metaphors I used was the University of Wisconsin Hospital and Clinics (link: http://www.uwhealth.org/files/
Science writing and fiction really have a lot in common. Keep the reader interested. Make your point. Avoid unnecessary detail and random tangents. Help your readers know where the story is going and don’t let them get lost.
Simple, see? No PhD required.
0 comments:
Post a Comment