YA Roundup

Meet Liza from Prisoners in the Palace - Day #4

2010-10-28T06:38:00.000-07:00

In Michaela MacColl's debut, Prisoners in the Palace, Liza's luxurious life came to a halt when her parents were killed in a carriage accident, leaving her an orphan. Now homeless and with debts to pay, she acquires a job as a maid to Pricess Victoria - but with a catch, she must also act as a spy! I hope you enjoy this interview with Liza!

Your luxurious lifestyle and expecting to join society must have made becoming a maid hard to swallow. What was the toughest part?

The sleeping arrangements were definitely my most difficult obstacle! I was used to feather beds and sheets of silk. My bed at Kensington Palace was lumpy and I was always cold. You never realize how much you take for granted just being warm! I wrapped myself in my mother’s Kashmir shawl just to keep the chills away. Even the lack of a private bath pales in comparison to my nightly struggle to find a comfortable spot to sleep.

Do you think you and the Princess would have become friends had you met up different circumstances (assuming she was allowed out of course!)

What an amusing question, as Victoria might say. I do think we would easily have been friends if our ranks were equal. We had very much in common. We both love fashion, music and the theater. We could dance the night away at balls and fall madly in love with tenors at the opera. So long as we did not discuss matters of social policy or anything too intellectual, we could be close confidantes. And as a lady should never be too political or intellectual, Victoria’s company would be excellent discipline for me not to get unladylike ideas!

Why do you think it took so long for Elizabeth to stand up for herself?

Many young women from my background never learn to stand up for themselves. It is actively discouraged by the adults who try to safeguard us. If my life had gone according to plan, I would have been handed from my father’s care into my husband’s. It was fate’s intervention that gave me the opportunity to learn what inner strength I might draw upon. It helped that I first learned to stand up for others before myself.

Do you plan to visit, the now Queen Victoria, in the future?

Of course I do! After all we went through together, how could I resist seeing her in all her royal glory? I hear that she will leave Kensington Palace, so I’ll have to visit her in the new palace at Buckminister. I must also confess to being wildly curious as to how Victoria will handle all that power! She’s not accustomed to making her own decisions. I hope she makes good ones, not just for her own sake but for the nation’s.

If you could say one thing to Simon now, what would be it be?

Hmmm. I think perhaps I would tell him to think twice before he is seduced again by the promise of wealth and rank. Just because the aristocrats seem to have everything in life they could ever want, the truth may be very different. It doesn’t pay to envy your betters.

------------------------------------------------------------------------------------
Today is the last day to enter the giveaway...Click here to enter!

Cross-posted at: He Followed Me Home...Can I Keep Him? on 28 October 2010.

An Interview With Michaela MacColl

2010-10-27T05:43:00.000-07:00

I hope you are enjoying learning more about Prisoners in the Palace! Today on the blog is an interview with the author, Michaela MacColl. If you haven't already, don't forget to click on the giveaway link at the end of this post.

You have a background in history. Was being an author something you always dreamed of?

I fell into history accidentally through literature. I was reading a fabulous edition of Russian fairy tales when I needed to declare a major. I ended up designing an independent program that looked at the end of the Russian Empire and the beginning of the Soviet one from many different disciplines. To the extent that I thought about the future, I saw myself as a professor. However, two years of graduate school killed that dream! I found that to get a PhD, you had to take all the fun out of the history. Happily, I found a way to put it back in!

One of the surprises I found in your author's note was the existence of Inside Boy Jones (although portrayed differently in your book). What fascinates you the most about Inside Boy?

The 1830’s in pre-industrial England were a grim time for the poor. The very limited social safety net, poor houses, had been dismantled by a thrifty government. Instead, they put the burden on the local parishes. If you were born in Surrey, it was Surrey’s job to take care of you if you were indigent. (Sound familiar?) Of course the parishes weren’t equipped to do this and a lot of people ended up desperate.

Inside Boy is a quintessential London Cockney, who lives by his wits, both in real life and in Prisoners in the Palace. He’s found an ingenious way to let the monarchy pick up his bed and board. I found the idea of a clever character who was intimately familiar with both the streets of London and the drawing rooms of the Royal family fascinating. He has a unique perspective and specialized skills that my heroine, Liza, is quick to make use of.

If you could go back in time, where would you go?

It’s a tough question, because I like my creature comforts! However, if I had to choose, I would probably pick Elizabethan England. To see Shakespeare performed as it originally was or to see the Spanish Armada sink – that would be a blast! And if I could fast forward, I think I would love to visit Prince Albert’s Great Exhibition of 1851 and the Crystal Palace.

My BFF and I plan to one day tour the castles in Europe. Have you ever been so lucky to visit?

I lived in France for almost four years with my husband, first in the south of France and then in Paris. We had just gotten married and we didn’t have kids yet. We traveled every weekend – Portugal, Spain, Italy, Austria, Germany – we went everywhere and toured as many castles as I could bully my husband into visiting. My favorite isn’t a castle, it’s the Abbey at Mont St. Michel in Normandy – put it on your list! Twice a day, the sea sweeps in and cuts it off from the mainland. Very romantic and spooky!

For Prisoners in the Palace I went to London to visit Kensington Palace and Windsor Castle. It was so important to the final book’s credibility. Of course, I had to rewrite huge chunks that I had already written to reflect what I saw.

Are you working on anything new?

I’m putting the finishing touches to my next novel, tentatively titled “Beryl Above Africa” (I’ m almost certain that this will not be the title!). It’s about Beryl Markham, who was one of the premier female aviators of the 1830’s. She grew up in Colonial Africa when it was just being settled. Beryl was raised by the African tribe who worked for her father and she learned to hunt lion and was mauled once. She grew up to be the first to fly the Atlantic from East to West. Although she crashed, she survived to write a wonderful memoir called West Into the Night.

Thanks so much for stopping by Michaela! Don't forget you have a chance to win a copy of Prisoners in the Palace or one of 5 bookmarks:) Click here to enter!

Cross-posted at: He Followed Me Home...Can I Keep Him? on 27 October 2010.

Fact vs. Fiction - Day #2 Prisoners in the Palace

2010-10-26T05:30:00.000-07:00

I'm excited to have Michaela on the blog today talking about the fact vs. fiction and how her debut, Prisoners in the Palace came to be. Please give a warm welcome to Michaela :)

When I began writing Prisoners in the Palace, I started with biographies. Victoria is one of the most heavily biographed women in the world (!!!) so there are a lot to choose from. But my task is easier because I concentrate on her childhood, usually only a chapter or two in most biographies. Within those chapters, I looked for nuggets to start me thinking… and that’s where the story comes from. The nuggets in this case were the restrictions on her childhood and the dreaded Kensington System which was what her education regimen was called. Since I’m a parent of teenage girls myself, I knew that the life Victoria led would be intolerable to my kids. But the everyday details of her life were fascinating too because they are at once so similar and so different to our lives today. The way I described her schooling, the music she studied, the tutors she had, what she ate, her daily toilette, etc. are all based on fact.

Another nugget was about broadsheets. It turns out in the 1830’s you could print anything you wanted on broad sheets of paper and sell them on the street. They were often used to promote political agendas. When Victoria was Queen, more than one was addressed to her and designed to influence her thinking – much like we might see a full page ad in the New York Times today. I began to think about how dangerous this kind of publicity could be… and my plot emerged.

The challenge writing about a public figure is that you cannot alter the known facts just because it would improve the story. I can’t make Victoria 20 just because I feel like it. Although one of my critique partners insisted it would be amazing if Victoria snuck out of Kensington Palace and had adventures in London, I had to (regretfully) hold my ground. There was no way that someone as protected as she was could ever have slipped away for any length of time. So I created a character, Liza, who could be close to Victoria but who had the freedom to leave the palace. Liza is a ladies’ maid, and I portrayed her life as accurately as I could, based on my research about servants to the aristocracy. The fate of poor Annie, the maid whose place Liza takes, was also based on research about the working poor of London at the time.

It’s ironic that some of the most useful research about this time in London can be found in literature. Dickens and Thackeray were great sources for language and social mores. One of my favorite research tools was a book called What Jane Austen Ate and Charles Dickens Knew by Daniel Pool. Another amazing tool is a website called www.victorianlondon.org run by Lee Jackson (an author of Victorian mysteries). He has assembled a massive full-text indexed amount of literature and commentary about Victorian London.

Thanks so much Michaela! Don't forget you have a chance to win a copy of Prisoners in the Palace or one of 5 bookmarks:) Click here to enter!

About the book:

London, 1836. Sixteen-year-old Liza's dreams of her society debut are dashed when her parents are killed in an accident. Penniless, she accepts the position of lady's maid to young Princess Victoria and steps unwittingly into the gossipy intrigue of the servant's world below-stairs as well as the trickery and treason above. Is it possible that her changing circumstances may offer Liza the chance to determine her own fate, find true love, and secure the throne for her future queen?

Meticulously based on new interpretations of history, this riveting novel is as rich in historical detail as Catherine, Called Birdy, and as sizzling with intrigue as The Luxe.

Interested in reading the first chapter? That's easy, click here!

You can find out more about Michaela on her: website, blog, Facebook, Twitter
Cross-posted at: He Followed Me Home...Can I Keep Him? on 26 October 2010.

It's PRISONERS IN THE PALACE week on the blog! (Giveaway)

2010-10-25T08:25:00.000-07:00

It is my pleasure to have a week of Prisoners in the Palace on the blog. I really enjoyed Michaela's story of Liza, a maid to Princess Victoria in London, 1838 especially since I have recently been sucked into the world of historical fiction. Each day this week we will have something devoted to the book: character interviews, an author interview and more!

About the book:

London, 1836. Sixteen-year-old Liza's dreams of her society debut are dashed when her parents are killed in an accident. Penniless, she accepts the position of lady's maid to young Princess Victoria and steps unwittingly into the gossipy intrigue of the servant's world below-stairs as well as the trickery and treason above. Is it possible that her changing circumstances may offer Liza the chance to determine her own fate, find true love, and secure the throne for her future queen?

Meticulously based on new interpretations of history, this riveting novel is as rich in historical detail as Catherine, Called Birdy, and as sizzling with intrigue as The Luxe.

Interested in reading the first chapter? That's easy, click here!

About the author:

Michaela attended Vassar College and Yale University. She earned degrees in multi-disciplinary history. Unfortunately, it took her 20 years before she realized she was learning how to write historical fiction. Her favorite stories are the ones she finds about the childhood experiences of famous people. What happened that helped them to be great? Michaela has two daughters so she's hoping to identify those moments firsthand. She and her family live in Connecticut, but she will travel at the drop of hat to do local research. So far her travels have taken her to London and Florence and Amherst, Massachussetts. A trip to Shanghai, China is in the works. Prisoners in the Palace (Chronicle, October 2010) is her first book.

You can find out more about Michaela on her: website, blog, Facebook, Twitter

...and thanks to Michaela & her publisher, Chronicle, you have a chance to win a copy of Prisoners in the Palace or one of 5 bookmarks:) Please leave a comment and fill out the form below!
Loading...

Cross-posted at: He Followed Me Home...Can I Keep Him? on 25 October 2010.

Familiars Throughout History by Adam Jay Epstein and Andrew Jacobson

2010-09-08T00:00:00.000-07:00

Let's welcome the authors of The Familiars, Adam Jay Epstein and Andrew Jacobson for a guest post today! *applause*

Familiars are the animal companions to a wizard or witch. They are mentioned several times in the Bible, from Deuteranomy to Leviticus. Shakespeare's Macbeth had them, too. Familiars were common in Europe during the Middle Ages, and could be seen in the Salem Witch Trials of 1692. They existed in popular culture since the 1800s. The earliest and most recognizable of these magical assistants were the black cats of a witch. You’ve seen them on Halloween posters rubbing up against the leg of a woman dressed in black. Surely you are aware of some of the more famous familiars, like Harry Potter’s owl, Hedwig, or Gandalf’s horse, Shadowfax, or Merlin’s owl, Archimedes. Disney’s animated films added many more familiars to the lore, including Jafar’s parrot, Iago, Ursula’s eels, Floatsam and Jetsam, or Maleficant’s crows.

One thing in common with all of these depictions was that familiars always seemed to be sidekicks, relegated to the background, never having their own story. We decided to take a traditional fantasy world, one whose conventions were at once familiar and recognizable, and shift the perspective to that of the animals. For the first time, the adventure would rest on the shoulders of the familiars. The mythology of familiars is one that in many ways had yet to be explored. Where did they come from? How did they get their magical powers? Do they even have magical powers? How are they linked to their witch or wizard? All of these were questions that we were curious about, and questions that we strove to answer. We hope that readers will never look at their family pet the same way after reading this book, perhaps wondering if they too possess some kind of magic.

Who’s your favorite familiar? And what kind of magical power do you imagine your family pet has? Please comment here or swing by our blog, http://thefamiliars.blogspot.com.

You can learn more about “The Familiars” at www.thefamiliars.com.

Meet the authors, or check out the book trailer for The Familiars here:

ADAM JAY EPSTEIN spent his childhood in Great Neck, New York, while ANDREW JACOBSON grew up in Milwaukee, Wisconsin, but the two met in a parking garage out in Los Angeles. They have been writing for film and television together ever since. The Familiars is their first book.

One day, Adam asked Andrew, “Are you familiar with what a familiar is?” And from that simple question, Vastia was born, a fantastical world filled with the authors’ shared love of animals and magic. They wrote every word, sentence, and page together, sitting opposite each other.

Adam Jay Epstein lives in Los Angeles with his wife, Jane, their daughters, Penny and Olive, and a black-and-white alley cat who hangs out in their backyard. Andrew Jacobson lives with his wife, Ashley, and their dog, Elvis, four traffic lights away.

THE FAMILIARS will be produced for film by Sam Raimi and Sony Animation.

Sam's Support

2010-07-09T07:54:00.000-07:00

Hello everyone! Today Change of Heart week continues with an interview with Sam. Sam is an important character to the story as he is Emmi's boyfriend. Sam and Emmi start going out right before she gets sick and so their relationship is really new and they both go through a lot during the course of the book. Please welcome Sam to the blog and I hope you enjoy learning more about him.

Full Name: Samuel Paul Hunter

Nickname: Sam

Age: 16

Favorite food: Hamburgers, except when I’m training, then it’s steamed fish (only kidding—I hate steamed fish).

Favorite color: Navy Blue

Favorite number: 12-my baseball number

Favorite kind of music: Rap

Please tell us a little about you.

I play baseball for North Village High. Unlike a lot of my buddies, I’m pretty good at school and that’s important to me. I mean, I love sports and hanging out and talking about hot girls, but I also want to do other things, too.

What do you like to do in your free time?

Right now I mainly study and play ball. I’ve been hanging with Emmi, which has been fun, too, even if she can’t do that much.

What has it been like dealing with Emmi’s heart condition?

I’m trying to be patient about it, but sometimes it’s a bummer—on a lot of levels, if you know what I mean. It would be nice to be able to take her out or to do something a little more active than sitting on her couch. She’s been pretty brave, so I’m trying to be brave, too, but once in a while I realize how sick she is and it’s scary.

Has your life changed at all as a result of Emmi’s illness and near death experience?

Totally. I’m more aware of death and dying. I’ve been a little nicer to my parents and am trying to be nicer to my sisters.

What is one of your favorite memories of Emmi?

The thing that made me notice her was when she scored those two goals in the last minute of her soccer game. She was amazing. I don’t like prissy girls and think it’s very cool that she’s such a good athlete.

Is there anything else you might want people to know about you?

As I mentioned before, I’m more than a dumb jock. Sports are cool, but I know that it’s academics that will get me somewhere.

Thanks for stopping by Sam! If you would like to learn more about Sam then be sure to pick up a copy of Change of Heart by Shari Maurer today.

This interview is cross-posted on Ticket to Anywhere.

Emmi's Change of Heart

2010-07-07T07:53:00.001-07:00

Hello everyone! Today I am pleased to continue Change of Heart week with an interview with Emmi. Emmi is the main character ofChange of Heart. She's 16 up until she got sick she was an active soccer player and just your typical teen. Please welcome Emmi to the blog and I hope you enjoy learning more about her.

Full Name: Emmi Miller

Nickname: none

Age: 16

Favorite food: sushi

Favorite color: purple

Favorite number: 12-Sam’s baseball number

Favorite kind of music: Popular music. But I’m starting to get into old rock bands with my friend Abe

Please tell us a little about you.

For most of my life, it’s been all about the soccer. I play on an elite travel team, my school team and I even got to play in Europe last summer. I’m working my butt off to try to get a college scholarship. But now I got sick and without a heart transplant I might die. So in order for me to live, some other person must die. How do you wish for that? How do you not? It’s a horrible thing to think about.

Tell me about your parents. How well do/did you get along with them?

My dad’s the best. He totally got me into soccer and he even plays on an over 40 team. My mother is another story. She can be the biggest buzz kill ever—constantly on my case. She just doesn’t get me. She’s gotten a little better since I’ve been sick, but I’m wary.

What do you like to do in your free time?

Now—not much. I sit around my house, make photo collages and wait for someone to text me or IM me. Life is going on all around me and I’m stuck waiting.

Could you share with us a little about your life before you got sick?

It was mostly soccer, soccer and a little more soccer. I have a bunch of close friends: Becca, Lauren and Noelle. They’re all my soccer buds, but we hang out a lot off the field, too. I’ve always been healthy, and I guess I just took that for granted.

How has the need for a heart transplant changed your life?

I’ve found a patience I didn’t know I had. I used to be all about the doing, but now life is about the waiting. Not much I can do about it. Sometimes I’m chill, but other times I’m crazy frustrated. My friends are good to me, but I think they’d much rather be doing their usual thing than sitting around entertaining me.

Is there anything else you might want people to know about you?

Even if I sound cranky about all of this sometimes, I’m really not a bad person. When this is all over I want to play soccer in college and maybe even professionally. But I also want to go to Mongolia or someplace like that and teach kids English and help them.

Thanks for taking the time to stop by and answer some questions. If you would like to learn more about Emmi and her journey then head to your nearest bookstore and pick up a copy of Change of Heart by Shari Maurer.

This interview is cross-posted on Ticket to Anywhere.

Author Interview: Shari Maurer

2010-07-06T23:01:00.000-07:00

Hello internet! Today I am pleased to welcome Shari Maurer to the blog. Shari is the author of Change of Heart which was released by Westside Books on 23 April 2010. Change of Heart is an endearing story about a teen girl whose life is turned upside down when she learns that she needs a heart transplant. Its a book that will touch your heart and make you think about what is important. I hope that you enjoy learning a little bit more about Shari and her book, Change of Heart, as I had a lot of fun interviewing her.

First off…tell us a little about you?

I live in New City, NY—an NYC suburb where I also grew up. I’ve got 2 ½ teenagers in my house (my daughter is 15, my son is 13 and my other son thinks he’s 13, but he’s only 10). Life is filled with sports, dance, homework, etc. and my house is often overrun with kids. Somewhere in between it all, I try to find time to write.

What is your writing process like?

My best writing happens with a big cup of coffee next to me and my iTunes playing softly in the background. I was finding the internet was easily distracting me, so I bought a netbook, with the firm rule that I can’t do any internet stuff (well, okay, I do allow myself to check e-mail occasionally, but that’s all).

Which line do you find more difficult to write? The first or the last?

It varies from book to book. With Change of Heart, my editor and I struggled with that last line. I’m a big believer in the importance of first lines. I love that Emmi’s first line is: “Don’t give up.” It works for the first scene, but it’s really a theme of the book.

When you write, which comes first title, plot or character(s)?

With Change of Heart, I got the title pretty early and knew that I wanted it to have several meanings so I was able to form the plot from that (you’ll have to read it to understand!)

Where did you get the idea for Change of Heart?

My husband is a cardiologist who cares for patients who are waiting for heart transplants. One day we were watching a program on heart transplants on Discovery Health and there was a little girl on the program who was waiting for a transplant. I was absolutely haunted by the look on her face as they wheeled her into the OR to receive her transplant and my writer wheels started turning.

Which of your characters is most like you? Are any based on real people?

Both Emmi and her mother probably have a little of me in them. Emmi certainly has my crummy, difficult hair. I have a daughter and two younger sons, so the structure of the family mirrors mine (and my daughter would say, so do the annoying, always wrestling, brothers). I have an Aunt Mindy, but I only borrowed her name—she’s nothing like Aunt Mindy in the book. For that matter, I borrowed lots of names from our friends and family. Thanks, everyone!

When you finish a book who reads it first?

My daughter is often my first reader. She is the one who has dictated what and how I write. When I started writing Change of Heart, she asked for short chapters and IMing. I’ve included both of those and I think it makes for a very quick and easy read. Last summer she came home from sleepaway camp so happy and obsessed, that I decided to set my next book at a camp.

I also have a critique group with two very talented writers. They are amazing at looking at what I wrote and seeing exactly what works and doesn’t work. I can’t speak enough about the importance of having good critiquers.

Ugh....short chapters are the worst! They are just so dangerous! I often find myself up far later at night than planned because I tell myself just one more chapter since this next one is so short....authors of the short chapter are just evil....evil I say! lol

I also love how your daughter is the first to read your books. What a great way to tap into your target auidence and to also do a bit of bonding at the same time. =)

What’s your most embarrassing childhood memory?

Stealing Razzles (“first it’s a candy, then it’s a gum”) from a candy store. My parents made me go back into the store and confess.

haha I did something similar once....and got caught as well....man did that walk into the store suck.

What’s your idea of the best meal ever? What sort of foods do you like to eat when you are sick?

We play the game “What would your deathbed meal be?” at my house. (It comes after the “What’s your favorite chocolate: milk, dark or white?” game.) Mine would be vichyssoise for my appetizer, tuna steak au poive with spinach and mashed potatoes for the main course and then white chocolate mousse pie for dessert. Yum!

When I’m sick, I don’t eat much. Mainly I drink a lot of tea.

For the record....my favorite chocolate is Dark....followed by white. I only like Milk if its Cadburys from the UK. You know....inf case anyone out there ever wants to send me chocolate. ;-)

What’s something that made you laugh out loud today?

My kids make me laugh on a regular basis. My husband and his brothers have great senses of humor and it seems to be genetic.

If we were able to take a peek at your nightstand, what book(s) might we find there?

My TBR pile right now is HUGE! I’m currently reading Shade by Jeri Smith-Ready, who is a Class of 2K10 mate of mine. Next up: Harmonic Feedback by fellow Tenner Tara Kelly. I’m part of two groups of debut authors: the Class of 2K10 and The Tenners and have been enjoying their books. They all have so many amazing books out, which explains my huge TBR pile.

I have both those books on my Mt TBR too. Really need more time to read!

What is the book that you most want to read again for the first time?

To Kill A Mockingbird, one of my all-time favorites.

ooohhh.....good choice! LOVE TKAM!

Are there any books that you might have lied about reading (we promise we won’t judge)?

I was an English major in college, so I’ve had to read a lot of the classics. I don’t think I’ve ever lied about it, though. And I don’t think I ever read the Cliff Notes (1980’s version of Spark Notes) instead of the book.

What’s a book you’ve been a book bully for? (ie one you’ve liked so much that you practically beat people over the head just to get them to read it)

I’m in a book club. Lately, we’ve been taking turns making the selection, so once every eight books I actually get to be the official bully and they don’t have a choice! My pick this month is Wintergirls by Laurie Halse Anderson. I had an exciting fan girl moment at BEA last month. I met Laurie, who was so lovely and gracious and welcomed me to the “sisterhood of published authors” as she put it. I even got to tell her that our book club was reading Wintergirls. I would bully for almost all of Laurie’s books—I think they’re the gold standard of YA writing.

The Zombie Apocalypse has started, do you have a zombie plan? Can you share your plan with us?

I’m embarrassed to admit it, but I had to Google “Zombie Apocalypse” to figure out what it was. But now that I know, I guess it would be to throw everyone in the car with as much food and water as we can fit and head to my parents’ house in the Berkshire Mountains of Massachusetts. They’re pretty isolated up there, so maybe the zombies wouldn’t find us.

Note to self: do not rely on Shari when the Zombie Apocalypse comes....

Can you share a little of your current work with us?

I have a wonderful book that my agent and I are trying to find a home (more details soon, hopefully). And as I mentioned earlier, I’m writing a book set at summer camp. I won’t go into more details, but right now it’s a promising first draft that needs A LOT of work. I’m looking forward to having some concentrated writing time this summer to get it to where it needs to be for me to allow it to leave my house.

Loved summer camp as a kid - though I only went for one summer - so looking forward to another book about it. =)

Do you have anything specific that you want to say to your readers?

I’ve been talking the opportunity during this blog tour to speak as often as possible about the importance of organ donation. Emmi waits a long time for a heart and this is not atypical. Please consider registering to become an organ donor. I hope you never need it, but if something awful happens, it would be great to know that you could save several lives. For more info go to: www.donatelife.net. Thanks!

This interview is cross-posted on Ticket to Anywhere.

Fun Friday...and winners!

2010-06-18T05:34:00.000-07:00

I hope you enjoyed your week of Claire de Lune! A big thank you to Christine for making this possible. For the Friday's posts, we discussed making a playlist as I always like to do something fun...

So after much agonizing, I finally did a playlist just of the arc
of Claire's story - a Claire playlist, rather than a CLAIRE DE LUNE
playlist, if that makes sense. Originally, I tried to pick one song for
each character, but I was getting into WAY too many spoilers and getting
all twisted up with it. Instead, I tried to find really great songs that
matched Claire at each point in her journey, both with their lyrics and
also the general feel of the music. This is what I ended up with!

Thanks to everyone who played along.

And the winners are.....

Signed copy of Claire de Lune: Jessica

Bookplates: Katelyn, Jenny N, Grace Gorski, Natasha, Elie N and Okapi

Please check you emails, you have until Sunday to claim your prize :)

Cross-posted at: He Followed Me Home....Can I Keep Him? on 18 June 2010.

Learning More About Matthew

2010-06-17T05:25:00.000-07:00

It wasn't a surprise that when I went to interview Claire, Matthew was close by. Being the main character and all, we know a lot more about Claire so my questions for Matthew (who by the way is a total sweetheart!)were a little more deep. Again, not to worry these are spoiler-free!

What was it about Claire that made you fall head over heels for her?

She’s so *herself.* I was so tired of dating girls that spend all their time playing games, trying to be whatever they thought I wanted them to be. And Claire was so smart and funny and quiet without being shy. I just never thought she’d be interested in dating someone like me - that she’d think I was just another jock. She’s so strong and amazing, and not just because she’s a werewolf. It’s just *her.*

Will your scientist Dad would ever understand if you told him about you and Claire?

My dad is really...focused. He’s spent practically his whole life trying to perfect his cure for lycanthropy. I don’t think he would be able to get over that - to see Claire for the amazing person that she is. I wish he could see past her werewolf side. That he could think of her as something other than a dangerous test subject. But I just don’t think he’d be able to do that. And I’d never, ever want to risk Claire’s life by trying to find out for sure!

Do you think more people could be like you and accept werewolves for who they are as humans and not just see them as animals?

I wouldn’t be surprised - I think if people knew that these nice, normal women that they see everyday are werewolves, maybe they could get past all the stereotypes. I know that everyone’s scared of attacks, but humans kill each other, too, and we’re not terrified of every person we pass on the street. It’s not fair that people like Claire and Marie and Beatrice have to spend their whole lives hiding. Maybe someday, they’ll be able to live in the open. I hope so.

Doesn't the thought of your girlfriend turning into a wolf kinda freak you out?

Yes and no. I mean, the wolf world is really intense and there’s not a lot of room for humans - especially human guys - there. So that’s a little hard sometimes. But Claire’s wolf side is half of who she is - with out that, she wouldn’t be *her.* And I love the person that she is - strong, smart, wild and contained at the same time. So, no, the thought of her transforming doesn’t make me want to run away and hide or anything, but figuring out the wolf part of her world has been kind of hard at times. Worth it though. Hard, but totally worth it.

This week you have a chance to win a SIGNED copy of Claire de Lune (CAN/US only), OR one of six signed bookplates (open internationally!) by filling out the form here. Don't forget you get an extra entry for each thoughtful comment :)

Cross-posted at: He Followed Me Home...Can I Keep Him? on 17 June 2010.

Chatting it up with Claire

2010-06-16T06:48:00.000-07:00

At 16, the main character in Claire de Lune finds out that she's...well a little bit different! I had a chance to ask her a few questions, don't worry it's spolier-free :)

Did you ever think, growing up, that your family was a little odd?

Not really. I mean, I knew my family was different than, say, Emily’s family, but it just seemed NORMAL to me. Plus, once Lisbeth came, it actually seemed easier than having my mom around all the time, breathing down my neck about stuff. I was so happy that she wasn’t prying into my secrets that I didn’t really think she might have one of her own!

How long had Matthew been on your radar?

Um, since the first day I walked into school? No, seriously. He was a sophomore when I was a freshman, but we’d gone to different middle schools, so I’d never seen him before. His locker was sort of near mine that year, and he was so gorgeous, I couldn’t NOT notice him. But I never thought he’d actually pay any attention to me...

What is your favorite part of being a were?

I love the hunt. Really. I mean, I love so many parts of it - the heightened senses (even though that took awhile to adjust to!) and the running and the way we can communicate with one another without talking. But hunting rolls all that up together and adds the excitement of chasing something. Of course, at the end of the hunt, there’s always the killing part, which took some time to get used to, but it’s no different than eating a steak you buy in the grocery - and it’s a lot fairer to catch it yourself!

What do you think your BFF Emily would do if she knew the truth?

It’s so hard - I know that she would really, really *want* to keep it a secret, but she’s pretty much the worst secret keeper I know. I mean, it’s like the words just leap out of her mouth. I really want to tell her, but it’s just too big a risk, for everyone. When I can’t stand it anymore, I always remind myself that I can tell her tomorrow. That makes it sort of bearable, knowing that I always *could* tell her. Just not today.

(awww, love this answer!)

This week you have a chance to win a SIGNED copy of Claire de Lune (CAN/US only), OR one of six signed bookplates (open internationally!) by filling out the form here. Don't forget you get an extra entry for each thoughtful comment :)

Cross-posted at: He Followed Me Home..Can I Keep Him? on 16 June 2010.

Interview with Cass

2010-06-15T07:29:00.001-07:00

Hi Cass! Nice to have you on the blog today!

First off, could you describe yourself with three words?
Geeky. Sincere. Brave.

Julia and you planned to go on a road trip to California. Have you ever thought about which places you'd visit when you reached Cali? If yes, which three places would you visit?
We wanted to travel the old Route 66, which would have taken us into Los Angeles. I wanted to go up to Berkeley and San Francisco and over to Yosemite to see the redwoods, but we might not have ever had time for that. But we would have gone to see the Hollywood Walk of Fame and hung out on the beach, for sure.

I want to go to the Hollywood Walk of Fame too!

What are some songs on your iPod?
Okay, I know that I'm the very last person on earth to not have an iPod, but I don't have an iPod. I don't really have the cash to spare right now, and besides, I get everywhere on my bike. And I refuse to bike with headphones on. You can't hear what's going on around you and it's absolutely suicidal. Having said all that, I'm listening to a lot of Led Zeppelin and Queen right now.

Julia was your best friend for a long time, what was your first impression of her?
She was so friendly and outgoing. She treated it as a foregone conclusion that we were going to be friends now and she didn't want to hear any arguments about it! She always wanted to be the center of attention and she'd drag me right into the center of attention with her.

What were some of the activities you did with Julia before the accident?
We used to do homework at each other's houses at least a few times a week. That sounds super dorky, but okay, we were both super dorky, and we both worked really hard in school, and when we had creative assignments we would crack each other up getting really creative with them. And I could watch MTV at her house because I don't have cable at home. We spent lots of time hanging out with her theater friends too, and I always tried to help out on the set when she was working on a play.

Do not take this the wrong way but have you ever watched High School Musical? Like it or hate it?
You know what my life has enough of? Drama. And singing. And singing about drama. I'll watch a musical movie if one of my friends really wants to see it, but I can't say I've ever felt a deep longing to see High School Musical.

Would you rather travel to Australia or The North Pole if given the choice?
Australia, because there's big cosmopolitan cities and big stretches of wilderness, there's coral reefs and deserts, there's kangaroos and koalas and poisonous snakes. I couldn't get bored there.

Brilliant. In fact, I am sure we can find A Love Story in bookstores in Aussie! ;) Whoo hoo!

Thanks for stopping by Cass! Have a nice day.
Thanks for the interview!

This was cross-posted on Read This Book!

Emily Horner interviewed

2010-06-15T07:28:00.000-07:00

Hi Emily! Congratulations on the release of A LOVE STORY. Happy to have you here at Read This Book this week! Could you please share with us a little bit about yourself? We would love to learn more about you!
I was born in Canada and grew up moving around to Montreal, France, Texas, and North Carolina. I studied linguistics and Japanese in college and spent some time studying classical Japanese literature in Nagasaki. I'd always loved to write, but in Japan I got inspired by the do-it-yourself culture of fan-made comics and decided to get serious about it.

The idea of going on a road trip on a bicycle is really cool! Was it based on/inspired by a real event?
I've never gone bicycle touring personally. I really wanted to, and I still want to, but I'm not naturally athletic. To be honest I'm the opposite of naturally athletic. I was trying to build up my fitness and my endurance so that I could make a serious go of bike touring, but I moved to New York before I managed to do it. My stepfather did some bike touring in Canada in his youth, and I was also really inspired by a guy named Ken Kifer who has done some crazy bicycle trips -- once he did one with kittens in his basket! -- and who documented them on his web page at kenkifer.com.

In a A Love Story Starring My Dead Best Friend, the main character Cass goes on a road trip on a bike. When was the last time you rode a bike?
In 2007, before I moved to New York. When I was in grad school I went everywhere on my bike, but drivers here are really aggressive, and a colleague of mine was killed commuting to work on his bike. I wish I were braver about cycling, but I don't quite have the skills to hold my own against traffic.

But even though I don't bike so much these days, bicycle advocacy is really important to me. I grew up in the suburbs, where I depended on my parents to drive me everywhere, and I didn't get my driver's license until I was 24. Biking is good for the environment, it's good for your health, it's fun -- and it's important for me to live somewhere where I don't have to depend on a car to get around.

If you were spending the day with Cass, where and what would you do?
I want to say that we would ride bikes together, but she would leave me in the dust! But I love to show my friends around New York and figure out what they would have fun doing. So: biking along the Hudson River, lunch at Boneshakers cafe in Williamsburg where we could snicker at hipsters on their fixed-gear bikes, and going to the theater to see Wicked.

Have you ever been part of a musical? If yes, what was it about? If no, which musical do you wish you could be part of?
I was a tree when my sixth-grade class did Peter Pan, and that was the end of my career in the theater. But I learned from that that if you're going to work on a musical, you'd better be prepared to listen to all of the songs over and over and over and over again. So if I could be a part of a musical, it would be Hedwig and the Angry Inch, which is a tremendous amount of fun, and there's not a bad song on that whole soundtrack.

If you could meet one author, living or dead, who would it be?
Sei Shonagon, the author of "The Pillow Book," a book that is at times beautifully written and at times hilariously catty about 10th-century Japanese court life. I've always thought that she would be a ton of fun to hang out with.

If you could go back in time and tell your 16-year-old self a piece of advice, what would it be?
Don't buy into the narrowness of life in high school, and how you're told that you have to measure up to a certain standard of "normal." It's a big, big world out there and there is a lot of space to define who you are and who you want to be.

Kirkus called A Love Story "Bittersweet but never mawkish and punctuated with just the right amount of teen hipster humor." Ultimately, what would you like people to take away from your book?
There's a Leonard Cohen song that goes, "There is a crack in everything -- that's how the light gets in." Sometimes it's our worst moments, our most dark or selfish or vulnerable moments, that open us up to forgiveness and hope.

Are you currently working on anything? Is it ok if you tell us in one sentence what it is about? (unless it’s super top secret!)
I'm working on a fantasy novel about a girl working in a silk factory who gets entangled in political conspiracies, which will hopefully be out in 2012.

Is there anything else you would like to add before we go?
Thanks so much for having me, and you can check out my web site at emilyhorner.com for news and updates!

Stay tuned for more interviews and guest blog coming up later this week. And a giveaway at the end of the week!

This was cross-posted on Read This Book!

An Interview with Christine Johnson!

2010-06-15T06:12:00.000-07:00

I recently had a chance to talk to Christine Johnson about her debut, Claire de Lune. Please give a warm welcome to Christine. This week you have a chance to win a SIGNED copy of Claire de Lune (CAN/US only), OR one of six signed bookplates (open internationally!) by filling out the form here. Don't forget you get an extra entry for each thoughful comment (see her answer to my last question today!)

In your own words, tell us about the book

This is a much harder thing to do than it seems like, but here goes: CLAIRE DE LUNE is about a girl who discovers, on her sixteenth birthday, that she’s the latest in a long line of female werewolves. With a rogue wolf on the loose, her boyfriend’s dad leading the werewolf hunt, and her new identity to adjust to, Claire has to overcome huge challenges if she’s going to save her new-found pack . . . and herself.

In Claire de Lune, you have created an interesting take on the werewolf. What was your inspiration?

I thought it would be really interesting to write a book about a girl who was a werewolf, and it really all grew pretty organically from there. I thought it would be *more* interesting if all the werewolves were women - if there *couldn’t* be a male of the species. I spent a long time reading everything I could find about traditional werewolf mythology and then I turned a lot of it on its head, which was really fun. So much of the traditional lore is very male-centric - I wanted to come at it from a different (female) perspective.

My favorite scene to read was when Claire is in the forest, checking out her new skills. What was your favorite to write?

It’s REEEEAaally hard to talk about my favorite scene without being spoiler-y. But there’s a part near the end, when Claire has a big fight with someone who has been very important to her, and that fight has HUGE ramifications for Claire. It was a hard scene to write, because so much hinged on it, but when it finally came together, it was the *most* satisfying.

Did you ever have a boyfriend but kept him a secret from your family/friends?

Not that I can remember . . . but in high school, my serious boyfriends were always older guys who either didn’t go to my school or were in college. Honestly, they were all great guys (not that there was a huge roster of them or anything,) but I remember being sort of jealous of the girls who could slip notes to their boyfriends in between classes, or sit together in the caf at lunch. So I do know that feeling of having a boyfriend who’s sort of absent from one part of your life, even if none of mine were ever a secret.

What are you working on now?

I juuuuust handed in the first draft of the sequel for Claire de Lune, which will be out sometime next summer. It’s untitled . . . I’m working on that. I hate titles. I think they’re HARD. If anyone has any suggestions, I’d be happy to hear them!

To learn more about Christine & Claire de Lune, visit www.christinejohnsonbooks.com

Cross-posted at: He Followed Me Home...Can I Keep Him? on 15 June 2010.

A Love Story Starring My Dead Best Friend week!

2010-06-14T07:27:00.000-07:00

Hi guys, there won't be reviews this week either because I am hosting the slightly belated release week for Emily Horner's YA debut novel A Love Story Starring My Dead Best Friend which was released last week!

Here is the schedule:
Monday: Author interview
Tuesday: Character interview with Cass
Wednesday: Emily Horner guest blogs
Thursday: Character interview with Heather
Friday: Giveaway, win your own signed copy of A Love Story!

Synopsis: For months, Cass Meyer has heard her best friend Julia, a wannabe Broadway composer, whispering about a top-secret project. Then Julia is killed in a sudden car accident, and while Cass is still reeling from her death, Julia’s boyfriend and her other drama friends make it their mission to bring to fruition the nearly-completed secret project: a musical about an orphaned ninja princess entitled Totally Sweet Ninja Death Squad.

Cass isn’t one of the drama people. She doesn’t feel at home with Julia’s drama friends, and she doesn’t see a place for her in the play. Things only get worse when she finds out that Heather Galloway, the girl who made her miserable all through middle school, has been cast as the ninja princess.

Cass can’t take a summer of swallowing her pride and painting sets, so she decides to follow her original plan for a cross-country road trip with Julia. Even if she has a touring bicycle instead of a driver’s license, and even if Julia’s ashes are coming along in Tupperware.

A Love Story Starring My Dead Best Friend is a story about friendship. About love. About traveling a thousand miles just to find yourself. About making peace with the past, and making sense of it. And it’s a story about the bloodiest high school musical one quiet suburb has ever seen.

Excited for the book? Here's a teaser for you!

And then we were chasing each other around the workshop, not bothering with setting and aiming our weapons, but just throwing the little beanbags at each other, giggling when we could breathe enough to do it. As innocent as two six-year-olds in a water-gun fight. We scrambled over boxes and leaped over bits of props strewn on the floor.
(page 106)

A Love Story Starring My Dead Best Friend releasesd on June 10th! You can buy A Love Story Starring My Dead Best Friend at Book Depository or Barnes & Noble or Amazon or at the bookstore nearest to you. By the way, did you know that A Love Story Starring My Dead Best Friend is being published in Australia by Penguin Australia? Kangaroos, meet Cass and friends!

This was cross-posted on Read This Book!

Claire de Lune week (and giveaway!)

2010-06-14T05:39:00.000-07:00

We are excited to share with you a week of Christine Johnson's debut, Claire de Lune. Throughout the week you will find an interview with Christine, the main character Claire and Matthew. I hope you enjoy!

About the book:
Torn between two destinies…

Claire is having the perfect sixteenth birthday. Her pool party is a big success, and her crush keeps chatting and flirting with her as if she’s the only girl there. But that night, she discovers something that takes away all sense of normalcy: She’s a werewolf.

As Claire is initiated into the pack of female werewolves, she finds her lupine loyalty at odds with her human heart. Burdened with a dark secret and pushing the boundaries of forbidden love, she will be forced to make a choice that will change her life forever...

Praise:

“Johnson spins out an engaging and provocative riff on the werewolf tradition….Smooth writing and engaging main characters make for an easy read, while a feminist focus offers just a bit more for thoughtful readers….A good summer read for the romantically concerned or and monster-obsessed midteen girl.” - Booklist

"Johnson weaves a page-turning tale of forbidden love, loyalty, friendship, and deception that will leave readers eager for more. Strong characters and major plot twists coupled with a new twist on werewolf mythology make this a fun and entertaining read." - School Library Journal

“Johnson’s debut . . . glimmers with mystery and a budding romance amid Romeo and Juliet-like complications . . . her struggle to adjust and integrate the two sides of her life rounds out a satisfying story.” - Publisher’s Weekly

Book Trailer:

About the author:
I grew up in, moved away from, and finally came home to Indianapolis, Indiana. Now I live in an old house in an old neighborhood with my husband and kids. I have too many books and a weakness for anything sweet. I love yoga and cooking, but I'm not much of a movie person. I like watching soccer, and always look forward to the first sweater-worthy days in the fall. But mostly, I like making things up and writing them down and having people read them. So that's what I do, and I'm very, very lucky to be doing it!

www.christinejohnsonbooks.com

...and a big thanks to Christine for the great giveaways! This week you have a chance to win a SIGNED copy of Claire de Lune (CAN/US only), OR one of six signed bookplates (open internationally!) by filling out the form below. For each thoughtful comment you leave during the week, I will also add an extra entry.

Loading...

Cross-posted at: He Followed Me Home...Can I Keep Him? on 14 June 2010.

What would Heidi do if the world ends tomorrow?

2010-06-09T07:25:00.000-07:00

What would I do if the world is ending tomorrow?

Well that would depend.

Is it ending due to a) zombie apocalypse? b) 2012? Because on our way to the beach this past weekend we were driving on a windy, coastal mountain road and bicycles kept shooting us strange signals with their hands like "Something is ahead," and since we are a bit of a zany family, we were like, "What if that something is ZOMBIES?" and we imagined them walking slowly up this winding road and were running ideas--like, "We could run them over? We can try and knock their brains out with our bow staffs?" etc., so it turned out to be not zombies, but what were they warning us about? I guessed a tsunami, since there are tsunami warning signs with arrows in Half Moon Bay--like in case of tsunami this is a safe spot--but I figured we'd know about that, and that the bicyclists wouldn't be so calm---so who knows what it was?

We never found out.

This is so ramblingly, but I guess if the world ending tomorrow I'd just do what I was doing. Surround myself with people I loved, and pray. Pray that our world wasn't ending due to slow-walking zombies rambling up a mountain road or a devastating tsunami that washed over the entire earth. o_O

Thanks for having me!

--
Thanks Heidi! Just a gentle reminder, Sea releases tomorrow, June 10th! You can buy Sea at Book Depository or Barnes & Noble or Amazon.

This was cross-posted on Read This Book! Remember, all comments on Read This Book will count as entries towards the giveaway at the end of the week!

Interview with Sienna 'Sea' Jones

2010-06-08T07:21:00.000-07:00

Hi Sienna, it's a pleasure to finally meet you! To tell you the truth, I am very curious, why does Spider call you 'Sea'?
Oh, because that was my nickname when I was a kid. I guess because I liked the ocean so much.

Could you share with us about what life was like before your mom's airplane disappeared? What were some of the activities you did together with her?
She was just awesome. We did the usual stuff, hung out. It wasn't so much what we did together, but more like how we were together. Does that make sense? She just got me.

Since going to Indonesia, how has it changed your life?
Oh, man. You'll have to read the story. I can't spoil you like that.

Oops! :P Looks like you, dear reader, will have to buy Sea to find out! ;) As you can see on the image on the right, the coconut drink is one of the exotic food (in this case, drink) Sienna tries while in Indonesia.

The Indonesian culture is very different compared to the American culture. Which ascept do you find the most fascinating?
How it is so different. How the kids were so unified, and treated each other like family even though they weren't always related by blood. They have such a strong sense of faith too, and coming from a pretty non-religious family that was really neat and curious. How much they trusted in something they couldn't see, but could feel. You know?

I completely understand.

Deni has been a great companion since you came arrived in Indonesia, what was your first impression of him?
His intensity. The hurt behind his eyes. I just wanted to stare at him, to be near him every second. It was magnetic right from the first moment I saw him.

What are two tourist attractions I should visit if I ever get the chance to travel to Indonesia?
Borobudur is really the only one I saw. I hear the beaches in Bali are awesome but I've never been there.

Wow, look at the time! It's getting late and you have to get back to the children. Thanks for stopping by Sienna! Have a nice day!
You're welcome. Thanks for having me!

Tomorrow Heidi will be guest blogging and the day after a huge giveaway for Sea and Sea tank top!

This was cross-posted on Read This Book! Remember, all comments on Read This Book will count as entries towards the giveaway at the end of the week!

Interview with Heidi Kling

2010-06-07T08:00:00.001-07:00

Hi Heidi! I'm pleased to host your release week for SEA right here at Read This Book! Could you please share with us a little bit about yourself? We would love to learn more about you!
Born and raised in California, I grew up all over the Golden State, changing schools every few years as my parents moved searching for the ‘ideal’ spot to raise their family. From very early on, I discovered a love of writing and creating—whether my words were in the forms of songs or poems or neighborhood plays. Even if I was at a brand new school, I always felt at home putting pen or marker or crayon to paper.

What was the inspiration behind Sea?
SEA was inspired by my husband's real life volunteer work in Indonesia. The story can be found at Heidi's website.

If you were spending the day with Sienna, where and what would you do?
Hanging out on the beach probably.

Have you done any volunteer work? If yes, where and what was it for?
Yes. I was a Candy Striper in high school at a local hospital, I volunteered at a nursing home later on--and a bunch of other things along the way. I've never volunteered abroad but I'd like to once my kids are grown.

If you had a time machine and can travel to Indonesia in any year, which year would you travel to and what will you do there?
I think I'd go now so I could meet the boys I've grown to care about who live there.

If you could meet one author, living or dead, who would it be?
Shakespeare.

If you could go back in time and tell your 16-year-old self a piece of advice, what would it be?
Hang in there. You're life will be awesome one day. Then I'd show her a picture of her two beautiful kids and her book cover for SEA. She would never believe me, but like Shrek in the movie I saw today I hope she would come to in time.

If someone told you 20 years ago that you would be a published author, what would your reaction be?
See above. :-)

L.K. Madigan said "From the first page of SEA, the reader is plunged into a world of love, loss, and hope. The heat between Sienna and Deni is mirrored in the steamy exotic setting of Indonesia." Ultimately, what would you like people to take away from your book?
The idea that hope, that love, that family is real. That bad things happen, but good ones do too. I love L.K.'s blurb so much. Also Jennifer Hubbard said, "Miracles and tragedies co-exist" and I think that is dead-on. Everything in life is a mix of both and when you're a teenager is so hard to remember that. This too shall pass.

Is there anything else you would like to add before we go?
Keep checking my website for updates on my signings and projects. And the SEA tank-tops should be available SOON on my website SEA STORE. Can you tell I'm very excited about those tanks? Thanks for having me Kate!

Come back this week for more awesome posts related to SEA!

This was cross-posted on Read This Book! Remember, all comments on Read This Book will count as entries towards the giveaway at the end of the week!

Sea week!

2010-06-07T07:58:00.000-07:00

Hi everyone, this week Heidi R. Kling will be at Read This Book! for some fun interviews and hilarious guest blog. :) At the end of the week, a signed copy of Sea will be given away together with a Sea tank top! Awesome, no?

Here is the schedule:
Monday: Author interview
Tuesday: Character interview with Sienna 'Sea' Jones
Wednesday: Guest blog on if the world ended tomorrow..
Thursday: Character interview with Deni (Release day!)
Friday: Giveaway!

Right now, the date has not been confirmed but Heidi will be having a chat sometime this month!

Haunted by recurring nightmares since her mother’s disappearance over the Indian ocean three years before, fifteen-year old California girl Sienna Jones reluctantly travels with her psychiatrist father’s volunteer team to six-months post-tsunami Indonesia where she meets the scarred and soulful orphaned boy, Deni, who is more like Sea than anyone she has ever met.

She knows they can’t be together, so why can’t she stay away from him? And what about her old best friend-turned-suddenly-hot Spider who may or may not be waiting for her back home? And why won’t her dad tell her the truth about her mother’s plane crash? The farther she gets from home, the closer she comes to finding answers.

And Sea’s real adventure begins.

Sea releases on June 10th! You can buy Sea at Book Depository or Barnes & Noble or Amazon.

This was cross-posted on Read This Book!

Interview with Maggie from Faithful

2010-06-03T08:15:00.000-07:00

Hello everyone today I have hopped in my handy dandy time machine and have gone back to the year 1904. 1904 was a big year some things that happened are: the US gained control of the Panama Canal, the Benfica soccer team was founded in Portugal, and Kaiser Wilhem II of Germany makes the first political recording using Thomas Edison's cylinder. There is also a huge fire in Toronto that destroys much of the city but had no fatalities. There is a tornado in Moscow and the 3rd modern olympic games opens in St Louis Missouri as part of the World's Fair. In Russia the Trans-Siberian railway is completed and the first underground line of the NYC subway opens. In November, Theodore Roosevelt is reelected President of the US and in December Charles Dillon Perrine discover's Jupiter's largest irregular satellite, Himalia and in NYC the first Times Square New Year's Eve celebration is held. This is the world that Maggie was born into where the modern age is really just beginning and taking off but that the old traditions of seasons and society are still holding on.

Full Name: Margaret Bennet
Nickname: Maggie
Age: 16
Favorite food: Trifle – it’s a dessert with layers of sponge cake, custard and fruit. Not that I can make it, but Cook does it wonderfully. It’s very rich and yummy. I have to let out my corset after I eat it.
Favorite color: Green
Favorite number: Seven
Favorite kind of music: The new thing called “ragtime.” But I wouldn’t tell Papa I listen to it – he’d disapprove. It’s too light-hearted for him.

Please tell us a little about you.

I’m still trying to find out who I am. I think I’m getting an idea – I like photography, now that I’m learning something about it from my friend Mrs. Gale. But what could I do with photography? Women don’t work after all, do they? I’m supposed to get married to the right man, have children, do charity work…but as I think about it, that sounds so boring. But I do like pretty clothes. I like being taken care of. I guess you could say I’m confused. Do I want someone to take care of me, or do I want to be independent?

Tell me about your parents. How well do/did you get along with them?

My father – Papa – he’s very depressed. We have a kind of wall between us. My Mama went away. Some people think she’s dead, but I don’t. I just want her to come home. We were very close. We used to spend time together, shopping and gossiping. But, when I think back, there was always something about her that I can’t put my finger on – some deep sadness. And Papa knew it. Oh, gosh, I think he loved her something awful, but he knew she wasn’t happy. When she left – disappeared – Papa went into a funk. I can’t get near him. I want Mama back so we can all be together again, like we were, happy, all three. Well, there. You’ve made me get emotional.

What do you like to do in your free time?

I like to ride. My horse – Ghost – he’s my first love. We understand each other. When I’m riding, Ghost and I are in our own world and nothing can touch us.

Could you share with us about your life in Newport before you made the trip out west?

Parties! Well, of course, there was school. I was decent student – not brilliant, but good. I worked even harder to please Papa after Mama left. But Kitty and I, we love parties. We were just coming into our season – when things really get lively – when I went west. When I look back, all those gorgeous dresses, the balls, the dancing…I do miss it.

What do you like the most about Montana? The least?

I love the landscape out west. The sky! It goes on forever – like a vast bowl stretched overhead. And the great mountains, with their snowcaps, and the rolling hills and the plains dressed with wildflowers. The animals, too, the elk with their towering antlers, and those foolish-looking moose. Except the bears – I could do without those. Yes, the bears scare me. Fascinate me, but scare me.

Is there anything else you might want people to know about you?

I’m not silly. I’m not like Kitty. Please don’t tell her I said that. But it’s true: I want to find out who I am and be taken seriously for who I am.

To learn more about Maggie and her journey west head to your nearest bookstore and pick up a copy of Faithful by Janet Fox.

This interview is cross-posted on Ticket to Anywhere.

Video interview with Janet Fox

2010-06-02T05:19:00.000-07:00

Hi everyone! Today I have a very special treat for you, my very first author video interview. This video was shot at the fabulous Books of Wonder in NYC (you can see their famous Wizard of Oz books collection in the background!) Janet is so very sweet and amazing that she took time after the Class of 2k10 book signing in order to chat with me about her recent book Faithful. Alea, of Pop Culture Junkie, was kind enough to be my videographer and after filming was done she rushed to the front and picked up Janet's book. I apologize for some of the background noise that is heard and if you have trouble hearing all of the interview just let me know and I'll transcribe it below. Janet was very sweet and I had a lot of fun doing this. As always I'm incredibly awkward and dorky....but I think its becoming part of my charm....so just ignore me and focus on Janet!

This is cross-posted on Ticket to Anywhere.

Faithful Character Interview: Tom

2010-06-02T05:17:00.002-07:00

Hello everyone today I have the great honor of presenting to you Tom Rowland who is a character in Janet Fox's debut novel Faithful. Faithful is primarily the story of "sixteen-year-old Maggie Bennet’s life is in tatters. Her mother has disappeared, and is presumed dead. The next thing she knows, her father has dragged Maggie away from their elegant Newport home, off on some mad excursion to Yellowstone in Montana. Torn from the only life she’s ever known, away from her friends, from society, and verging on no prospects, Maggie is furious and devastated by her father’s betrayal. But when she arrives, she finds herself drawn to the frustratingly stubborn, handsome Tom Rowland, the son of a park geologist, and to the wild romantic beauty of Yellowstone itself. And as Tom and the promise of freedom capture Maggie’s heart, Maggie is forced to choose between who she is and who she wants to be." (description taken from Amazon.com)

Full Name: Tom Rowland
Nickname: Tom
Age: 17
Favorite food: Ice cream! But only when I’m sharing with Maggie.
Favorite color: Blue
Favorite number: Five
Favorite kind of music: Mozart. The new phonograph I have – I can play a recording – amazing stuff – and listen to an entire Mozart sonata in my own house.

Please tell us a little about you.

I’m the kind of guy who loves the out-of-doors. My dad is a geologist who works out in the field mapping and collecting samples and I’ve been following him everywhere since I can remember. But I’m not much of a hunter. Not that I haven’t done my share of hunting; I just prefer my animals alive so I can watch them. Now give me a fly fishing rod and I could spend all day fishing. I have to work hard in school, but I have plans to attend the college in Bozeman, and hard work is what it takes, right?

Tell me about your parents. How well do/did you get along with them?

I have a lot of respect for my dad. He’s smart and quiet and he doesn’t mind taking me along with him when he works. My mom is a sweet, kind person who likes to volunteer at the local hospital – I guess that’s where I get my inclination for biology. You could say we’re a close family. We don’t argue much. Except maybe when I’m told to straighten up my room when I’m in the middle of a project. Even then I’ve never heard my mom raise her voice. She just gives me the look, you know?

What do you like to do in your free time?

Tramp around in the woods, mostly. And when I’m at school my favorite subject is biology, so I do a bit in my free time, too – like study how things adapt to their environments and stuff. This recent theory proposed by Mr. Charles Darwin, I’ve been reading a lot about it, seeing if I could find ways to prove it. It makes sense to me. But, hey, I also like to play baseball – we’ve got a team in Bozeman and we’re pretty good. I play second base.

Have you always lived in Montana? If not what are some of the places you’ve lived before?

Always in Montana. I was born in the Big Sky, and want to spend the rest of my life here. Oh, I hope to do some travelling, but not to fancy places. I want to see Africa, South America, Australia. I like camping, so roughing it isn’t a problem. I sure hope Maggie likes roughing it.

What do you like the most about Montana? The least?

What I like the most is the peaceful feeling I have when I watch the sun set over the mountains. I think this is what heaven is like. Now, I don’t mind the snow, which is good, because we have plenty of snow in the winter. But I could do without mud season – March, April. It gets old about then. It still snows, and it can be ugly and it feels like winter will never end.

Is there anything else you might want people to know about you?

I’m a pretty straight-up guy. And loyal, too. Which means I expect people to be like that with me. I won’t put up with fakery or snobbery. Maggie – I could see through her the minute we met. I think I know her better than she knows herself. I’m pretty sure she’s not a snob; I hope she won’t disappoint me.

This interview is cross-posted on Ticket to Anywhere.

Interview with Tessa from Tension of Opposites

2010-05-30T00:07:00.000-07:00

What is the best thing that happened since Noelle returned home?

Could you share with us about what life was like before Noelle was kidnapped? What were some of the activities you did together?

Hi Tessa! It is a pleasure to have you today! It has been quite a year hasn't it? First off, could you describe yourself in three words?
Thanks for having me! It has been an interesting year. Difficult, but amazingly perfect all at the same time. If I had to describe myself in three words, I’d say: Quiet – Shy – and Photographer.

Noelle was the best. Always laughing and trying to make me laugh. She could memorize a song the first time she heard it. That drove me crazy; I’d love to have that kind of memory. She liked attention, and never had trouble getting it. We were the cliché of what it means to be best friends: slumber parties, talking about boys, sneaking out of the house late at night . . . you know? Typical stuff.

Slumber parties are fun!

If you could capture one of your favorite moments on camera, which would it be?
Well, it hasn’t happened yet, but if I could dream my favorite moment it would be this: Me and Elle together now that she’s home, hanging out and laughing. It might sound simple, but it’d be this amazing thing if we could let every bad thing drop away and just laugh like we used to.

It hasn’t been one major thing, not since that first day I learned she was alive. It’s all about these little steps we’re taking toward a new friendship. At least, I hope that’s where we’re headed. Sometimes, I’m not so sure she wants to be my friend anymore. But I’m not going to give up.

I heard from one of your classmates that you have been very close with a certain guy... do you think you can share with us your first impression of him?
*blush* Is he going to read this? Because it might make him mad to know how much he freaked me out the day we met. My very first impression of him was that he could be some kind of psychopathic killer. Not that he was coming after me with a butcher knife or anything. Back then, that’s just how my brain was wired when I met some one new, especially alone, out in the woods. Killer or not, I can say I thought he was pretty hot.

Max is hot, indeed!

What are three things that remind you of Max? And why?
Sunflowers, snow, and trees. Some of my favorite moments with him happened while we were out taking pictures. If it wasn’t for photography, I’m not sure I would have opened up and allowed for us to become so close.

Speaking of Max, here he comes now. I don't want to hold both of you up any longer from taking pictures of those gorgeous sunflowers before the sun sets. Thanks for stopping by Tessa! Have a nice day!

Come back tomorrow and two lucky people can win this:

Cross-posted at: Read This Book.

Kristina McBride Dishes Out Behind-the-Scenes Trailer Detail

2010-05-30T00:04:00.000-07:00

I thought it might be fun for people interested in The Tension of Opposites to learn some interesting facts about the filming of the trailer. I also wanted to answer that little question a few of you who’ve already seen the trailer might be asking, “Where’s the third sister?”

One of my nicknames in life is “Listy Kristi”, so what better way to fill you in on some behind-the-scenes dish?

The trailer was directed and produced by Rocky Smith of Rock V Productions, LLC.
Rocky is a former student of mine, who I was fortunate enough to have in a Film & Literature course while he was a senior in high school. Rocky graduated from Wright State University with a film degree in 2008, and was willing to help me out with the trailer (shwoo!).
I actually had the pleasure of assisting Rocky during the editorial process of the trailer’s creation, analyzing every single frame of the footage along with him.
Rocky coaches cheerleading at a sports center near Dayton, and he pulled the girls who play Tessa & Noelle, and a third who performed the voiceover, from his competitive squad. The guy playing Max is an actor/director who Rocky worked with on a film project through Wright State University.
They are all still in high school, if you can believe that!
While filming the scenes in the dead sunflower field, Rocky and “Elle” suffered the icky-sticky issue of ankle-deep mud. They say they got a very good workout that day!
The Three Sisters, a very important location in the book, actually exist in Sugarcreek Nature Reserve near Dayton, Ohio.
The Three Sisters is one of my all time favorite locations – I hike there whenever I can find a few hours to spare.
Sadly, the middle sister, who had been weakened due to an earlier fire, fell to the ground during the summer of 2008.
I learned about her fall just as I began lengthy revisions on my manuscript, and was so upset that I would never see her standing again. But I felt proud that I had memorialized one of my favorite spots in my debut novel.

Now that you've read the Behind-the-Scenes secrets, check out the trailer!

Cross-posted at: Read This Book.

Interview with Kristina McBride

2010-05-24T07:27:00.000-07:00

here do you usually get your ideas?

Hi Kristina, it is my pleasure to host The Tension of Opposites here at Read This Book! Could you please share with us a little bit about yourself?

It is my pleasure to be here! I am a former high school English teacher turned YA author. This whole getting published thing has been a dream of mine since childhood, and I feel so fortunate to actually have reached this point. I mean, launch week? Crazy!

What first inspired The Tension of Opposites?
I was lucky enough to catch an episode of Oprah one day when she was interviewing Shawn Hornbeck, a young man who spent a little over four years with his kidnapper before being returned to his family. I was awestruck and inspired by his strength, and couldn’t get him out of my mind. Soon after, the character of Tessa began to speak to me (yes, I know this makes me sound a little loopy).

Anywhere. Everywhere! Friends, strangers, TV, commercials, music, my past, my fears, dreams for my future . . . every aspect of my life has somehow served as an inspiration. So if you know me, or if you ever meet me, watch out!

If you were spending the day with Tessa, where would you go and what would you do?
We would hike out to the Three Sisters (three 550-year-old oak trees that actually exist within Sugarcreek Nature Reserve near Dayton, Ohio) and take some pictures. If it was a hot day, we’d go hang out by the creek for a nice chat while we dipped our feet in the water. And then maybe we’d go for some pizza. And chocolate ice cream. Yum.

Tessa, the main character, is interested in photography. Are you a photographer like her?
I love taking pictures, but mostly my photography centers around people. My love of photography was born during my first year of teaching (1997), when I became a high school yearbook advisor and had roughly 400 pages to fill. After eight years of thinking intensely about the lighting and composition of shots, it’s just part of me now. Once I had my two kids, who are still very young, my photography began to center around them.

If you could meet one author, living or dead, who would it be?
One?! Warning: I’m totally cheating on this question. I’m thinking Laurie Halse Anderson or Jay Asher. I would love to pick their brains! How do they formulate a plotline? Create such well-developed characters? Add in such intense tension and drama?

If you could go back in time and tell your 16-year-old self a piece of advice, what would it be?
Don’t give up. EVER. Because if you do, you’ll never accomplish your biggest dream.

If someone told you 20 years ago that you would be a published author, what would your reaction be?
I think I would have been surprised that I actually made it happen. This has always been one of my biggest dreams, but back then, I had no idea how to go about making it happen. I figured out, along the way, that you have to ask tons of questions, make lots of mistakes, and above all, keep going.

The Tension of Opposites deals with the aftermath of a kidnapping and the impact on the victims. Ultimately, what would you like people to take away from your book?
The most important thing in my book has been evidenced in the media several times over the last ten years. There are missing children out there who are waiting to be found and reunited with their families. These kids oftentimes have been so brainwashed that they will not attempt to get away from their kidnappers, even if they have a very good chance. These are children whose parents don’t know if they are alive or dead, and are waiting for someone like you or me to notice something and tell someone. Think of Shawn Hornbeck, Elizabeth Smart, Jaycee Dugard . . . all it takes is one person’s keen eye to save a life.

Is there anything else you would like to add before we go?
If anyone would like to know more about my book (or me) they can check out my website at www.kristinamcbride.com. Thanks so much for having me and featuring The Tension of Opposites!

Tension of Opposites is out tomorrow, you can buy it at Book Depository or Barnes & Noble or Amazon. We are celebrating the release week for Tension of Opposites all week. Full schedule here, and you might just find some intriguing teasers. All comments in the release week posts will count as extra entires for the big giveaway at the end of the week!

Cross-posted at Read This Book.

The Tension of Opposites release week!

2010-05-24T07:22:00.000-07:00

Hey my fellow YA readers, this week we are celebrating the release of The Tension of Opposites by Kristina McBride!

Here is the schedule:
Monday: Author interview
Tuesday: Guest blog on National Missing Children’s Day and how it is related to The Tension of Opposites. It is also the RELEASE DAY!!
Wednesday: Guest Blog by in which Kristina McBride Dishes Out Behind-the-Scenes Trailer Details
Thursday: Character interview with Tessa
Friday: Giveaway
Saturday: Twitter Chat (8-9 PM EST, be there!)

If you spotted Tension of Opposites at your bookstore, let me know! You can take a picture and @reply it to me on Twitter and I'll RT it.

And if you missed it, here are the teasers of posted on YA Roundup's Twitter! None of them are spoilery! Enjoy! (And if you want more book teasers, follow YA Roundup!)

Teaser 1: It wasn't enough, just knowing that Noelle was alive and on her way back to us. So I sat there wondering if Noelle had screamed when she was taken. And if she had, why hadn't anyone heard?
Teaser 2: "That," he said with a grin, "is exactly why I like you."
Teaser 3: I had to stop myself from thinking about how much I liked being so close to him, and how sweet the grape jelly-bean scent was that rode Max's delicious breath, making me want to taste his tongue.
Teaser 4: Her goal in life was to make her way to a stage to feel the heat of a spotlight shining down on her face.
Teaser 5: I had told myself for two years that if Noelle couldn't experience that giddy, falling-in-love sensation, I wouldn't either.

You can buy Tension of Opposites at Book Depository or Barnes & Noble or Amazon.

Cross-posted at Read This Book.

Meeting Budding Superhero Amelia Tine, Half sister to... Who?!

2010-05-19T08:16:00.000-07:00

Today I am pleased to welcome Amelia Tines to my blog. Amelia is the half-sister of Damian Locke, who stopped by yesterday . I had hoped that Kat, Damian's girlfriend, but.....um.....well.....if you've read the story then you might know the sort of answer I got in response to my request. Fortunately though Amelia was more then happy to fill in for her.

First off, please tell us a little about you.

My name's Amelia Tines and I'm fifteen—almost fifteen and a half—and I'm a superhero. Oh, and I guess I'm Damien's half sister, but that better not be why you're interviewing me.

Um....no....that isn't the only reason why I am interviewing you. I swear. So um....moving on. What can you tell us about living in Golden City?

Golden City is great. Most superheroes go to specific schools where everyone's a superhero, but I go to regular school, so I'm the only hero. And everyone knows my dad's the Crimson Flash and has his own TV show, and my mom pretty much saved Golden City before I was born. Even though they should, nobody really pays that much attention to me at school, but I'm sure all of that will change next year, when I get my H and my flying power comes in.

If you could choose your superpower, rather then random genetics, which would choose?

Um, flying, duh. I want to be just like my dad.

What is the best thing about being a superhero? The worst?

The best thing about being a superhero is being someone everyone can look up to. People need superheroes, so if you are one, then you're automatically needed by everyone. The worst thing about being a superhero is having to wear spandex. It's not right for, um, every body type.

It's not just you Amelia. Spandex isn't right for anyones body type. What are you most looking forward to about going to Heroesworth Academy?

Having superhero friends and impressing my teachers with really good grades. Also joining the flying team once my power comes in.

What’s it like to suddenly have an older brother…especially one who turns out to be a supervillain? What’s been the best part about meeting your new brother? The worst?

Ugh. I already have one brother—I didn't need another one. And I was the oldest before he came along. Now I'm like yesterday's chopped liver. It's a good thing he's not staying with us permanently. The best part about meeting him is what a loser he is. Even if they won't admit it, my parents can clearly see how much better I am than him. He doesn't even want to be a superhero or fly or any of that, and I'm really passionate about all of it. So having him around emphasizes all of my best qualities, since his are so awful. The worst part about having him around is him getting attention and also talking to my friends. Can't he just mind his own business?!

Unfortunately Amelia, you are learning just what pains older brothers can be. I have one as well and I know exactly how they can be. lol

Well, thanks for taking the time to talk with me for a bit. Before we go, are there final words you’d like to say?

Yeah, I'd like to thank everyone for reading—you've been a great audience—and if anyone still has any questions about what it's like to be a superhero, especially one with famous parents, feel free to ask me tons of questions.

To learn more about Amelia Tine head to your nearest bookstore and pick up a copy of The Rise of Renegade X by Chelsea Campbell.

Talking to Real Life Supervillain, Damien Locke

2010-05-18T08:13:00.000-07:00

Hello Internet today I have a very special guest for you. It took a bit of tracking down as he is always on the move plotting evil plots and casing buildings....but after some plotting of my own I finally got Damian Locke to agree to sit down for a few minutes and answer some questions.

First off, please tell us a little about you.

I'm a supervillain, obviously. I've lived in Golden City my whole life, but I don't see why I'd want to be anywhere else. I mean, sure, this city has the highest population of superheroes in the U.S., but it also has the highest number of supervillains. Plus, having a few heroes around keeps things interesting. You have to have someone to mess with, right?

What can you tell us about living in Golden City?

Living in Golden City is great, if you don't mind the occasional raygun mugging or having to watch self-righteous superheroes like the Crimson Flash go around saving kittens out of trees. And, okay, if you were getting mugged by a supervillain with a raygun, he would prioritize that over getting kittens out of trees, but still. That's the kind of lame stuff that we have to put up with around here.

Rescuing kittens doesn't sound lame at all. But I guess it all depends on where your interests lie I guess. If you could choose your superpower, rather then random genetics, which would choose?

I would probably choose laser eyes, like my mom, so she'd think twice before using hers on me.

What is the best thing about being a supervillain? The worst?

The best thing about being a supervillain is getting ahead. I mean, if I'd been raised as a superhero, I probably wouldn't have even started Calculus yet. How can they expect to defeat anyone with those kinds of standards?

The worst thing about being a supervillain, for me, has been finding out I might not be a supervillain.

What are you most looking forward to about going to Vilmore? Or if you get denied admission due to your…um…unfortunate superhero parentage, what do you think Heroesworth Academy will be like?

Um, I'm SO not going to Heroesworth, so don't even ask that. What I'm most looking forward to about Vilmore—because I AM going to get in—is hanging out with my friend Kat and becoming an awesome troublemaking duo. We're going to be partners in crime, and I can't wait.

It must have been rough learning that you aren’t all supervillain and that you now have all these younger half-siblings, has the adjustment been hard since you grew up as an only child? What’s been the best part about meeting your new family? The worst?

Not only do I have three half siblings I never knew about, but they're all superheroes. (Go ahead and take a moment to gag. I'll wait.) They're all going to be able to fly, just like dear old dad, and they can't wait. Ugh. The best part of meeting them has been being glad I got raised by my mom and am nothing like them. The worst has been, well, everything else.

Thanks for taking the time to talk with me for a bit. Before we go, are there final words you’d like to say?

I'd like everyone to know that even though my dad's a superhero, I'm still all villain. So don't go thinking otherwise.

To learn more about Damian Locke and his struggles in learning of his mixed parentage head to your nearest bookstore and pick up a copy of The Rise of Renegade X by Chelsea Campbell.

Interview with Chelsea Campbell

2010-05-17T08:13:00.000-07:00

Today I am pleased to welcome the fabulous Chelsea Campbell to my little corner of the interwebs. For those who don't know Chelsea is the author of the newly released The Rise of Renegade X. Which is a simply amazing book and a must read! And after just a small amount of begging and Twitter stalking, Chelsea agreed to do an interview. =)

What is your writing process like?

While I'm writing, I have to have silence. Or mostly silence. If I'm already really into what I'm doing, a little noise is okay, but if I'm just getting started, then everything feels like an annoying distraction. Once upon a time, before my family had a computer, I wrote my novels on notebooks (a giant stack of them), but now that I'm used to the computer, I can't write them out longhand. I mean, technically I can still write things on paper, but my brain's not cool with creating on paper. I can't think properly about what words to put down unless I'm typing.

What was your worst subject in school? Your best?

My worst subjects in school were P.E. and Handwriting. At least in elementary school. I got Cs in both of them. Later, in jr. high and high school, it was P.E. and science classes. My best subjects were always English, Art, and Foreign Languages.

What was your first job?

I was an English tutor at my community college. It was a pretty okay job. I mostly got to sit and read, until someone needed help, and then it was mostly Japanese exchange students who needed help with little things like articles and prepositions. I could only work 16 hours a week there, though, and people kept being like, “Whoa, only 16 hours? You're going to get a 2nd job, right?” I lived with my parents and was in school full time, and writing like crazy on the side (though that never counts to the type of people who think you should have two jobs just because you can), so I was fine with only 16 hours.

What’s your idea of the best meal ever? What sort of foods do you like to eat when you are sick?

Oh, I'm so glad you asked this. I happen to know what the best meal ever is, because I have eaten it! It goes like this. A couple years ago, my parents came up for my college graduation and took us to Black Angus. And there was this big poster on the wall of a Father's Day special with steak, baked potato, a thing of King crab, and a freakin' lobster. I pointed to it and was like, “Whoa! Who needs all that food? Who do they think is actually going to order that?!” And then in true Chelsea fashion, I ordered it. And I ate every single bite of it—plus some potato skin appetizers my parents got, plus part of their baked Alaska for dessert—and every part of that meal was so delicious. I was afraid I'd get full and not be able to finish things, but what makes this meal the best ever isn't just that it all tasted awesome, but that I was able to eat everything I wanted to. I was on a roll.
What would your readers be most surprised to learn about you?

Hmm. Maybe not the most surprised, but pretty much every time I think the word “probably,” I also hear the Goose saying “probably-obably” in my head, as in, “You probably-obably could if you tried.”

If we were able to take a peek at your nightstand, what book(s) might we find there?

I very recently cleaned it (sort of), but up until a week or two ago, I had several lovely toppling stacks of books that included my ARC of The Rise of Renegade X, Bleeding Violet, a Latin textbook (Familia Romana, if anyone's curious), a book on Julius Caesar and one on Cicero, Roller Girl, Too Many Curses, Skullduggery Pleasant, and Before I Fall.

What is the book that you most want to read again for the first time?

Dragons of Autumn Twilight by Margaret Weiss and Tracy Hickman.

Are there any books that you might have lied about reading (we promise we won’t judge)?

I only lied about them in school! I would never lie about reading something in real life. But I may have not read the Iliad like I said I did. (I tried, though, I really did.) And I never finished Silent Spring back in high school. (I know; I'll pause a minute for you to gasp and be shocked.) It was the first book I didn't finish for school. I made it to the last 80 pages and then couldn't do it anymore. (If you haven't been forced to read Silent Spring, it's a non-fiction book about how DDT, a chemical sprayed to kill bugs, actually kills everything and gets into our systems and is awful. I don't think they use it anymore, because of this book, but being important doesn't make a book interesting.) We had a test on the book, or an essay or something (it was probably an essay) and I got away with just not mentioning the last 80 pages. But, I mean, that book is no page turner. I think getting that close to finishing is still pretty good.

What’s a book you’ve been a book bully for. (ie one you’ve liked so much that you practically beat people over the head just to get them to read it)

Writing the Breakout Novel by Donald Maass, and the workbook that goes with it. These two books saved my life. They made me think about the conflict in my stories and if I was having the worst thing possible happen at exactly the worst time for it to happen. They made me think about larger than life characters and raising the stakes until they're as far as they can go. Writing the Breakout Novel makes you ask yourself the right questions about your stories and characters to make them the best that they can be. After reading them and doing the exercises in the workbook, my writing was ten times better. I wouldn't be the writer I am today without them, and I might not even be published. So for a while I was really insistent that all my writing friends NEEDED to read this book. They always just kind of look at me like, “So?” and I can tell they're never going to. But a couple of them have now! One read it in practically one sitting, while he was sick, and was just as affected by it as I was.

When you write, which comes first title, plot or character(s)?

Characters! I've tried starting with title or plot first, and it never works out for me. Plot on its own is too boring for me, and I have to have characters I want to write about first and build a plot around them.

The edit process can sometimes be hard on a novel, are there any story lines and scenes that didn’t make it into the book? And if so, which one was the hardest to cut? Can you share a bit of it with us?

During the editing process, I had to tweak the scene early on where Damien goes to visit Kat at her house. In the original version, Kat told him she was talking like a pirate today, and so they had a few lines throughout where they were talking like pirates, and I totally loved that. But in fleshing out some storylines, I had to make some tweaks that made the whole talking like a pirate thing seem irrelevant. It would have felt tacked on if I'd left it, even though it was there from the beginning. It was for the best, but I do miss them talking like pirates!

Thanks for stopping by Chelsea I hope that you had as much fun as I did.

This interview is cross-posted on Ticket to Anywhere.

Fun Friday...and the winner!

2010-05-14T08:32:00.000-07:00

In Shade, Aura's boyfriend Logan is the frontman in the band The Keeley Brothers so I thought it would only be fitting to end off the week with some music!

Additional music links to share:

iTunes iMix (WARNING: clicking on link opens iTunes on your computer)

SHADE music page on Jeri's website, which includes a bonus playlist (Logan's St. Patrick's day mix!)

If you are curious, here's the playlist:

"Time to Pretend," MGMT
"Streams of Whiskey," (written by the Pogues, but performed by The Dead Rabbits on the iTunes mix and the Bloody Irish Boys on my website playlist)
"Dammit," Blink-182,
"Devil's Dance Floor," Flogging Molly
"Lust," The Raveonettes
"The Rip," Portishead
"Sleeping with Ghosts," Placebo
"Houses," Great Northern
"If I Ever Leave This World Alive," Flogging Molly
"Chasing Cars," Snow Patrol
"I Lost Lenore," The Nevermores
"St. Valentine's Day Massacre," Cocktail Slippers
"Love Song," The Cure
"Infinity," The XX
"I Will Possess Your Heart," Death Cab for Cutie
"The Bells Of Dublin/Christmas Eve," The Chieftains
"The Parting Glass," (traditional, performed by The Pogues on the iTunes mix and Ozark Four on my website playlist)
"This Is How I Disappear," My Chemical Romance
"Til Kingdom Come," Coldplay

I hope you enjoyed the week of Shade! A big thanks to Jeri for her time & support in making this happen. *throw confetti*

And the winner is.....

SANDY!!!!!!

Please check you email Sandy, you have until Sunday to claim your prize :)

Cross-posted at: He Followed Me Home...Can I Keep Him? on 14 May 2010.

Our Interview with Jeri Smith-Ready & Your Chance To Ask Questions Too!

2010-05-13T05:05:00.000-07:00

For those that don't know yet (gasp!), can you tell us what Shade is about?

Okay, here’s my amateur short version (not the extended magical marketing remix):
16-year-old Aura can see ghosts. Then again, so can everyone around the world who was born after her. In fact, they have a word for the moment of her birth: the Shift. Aura suspects that the Shift might be connected to her missing mystery dad and an event that happened at Newgrange tomb in Ireland a year before her birth.

Ghosts can be annoying at their best. At their worst, as dark, powerful "shades," they can be deadly. So Aura's major goal in life is to undo the Shift and make the ghosts go away.

And then, her boyfriend dies and becomes a ghost.

You have written many amazing adult fiction books with Shade being your first foray into YA. Was Shade started as YA or did it evolve that way?

It originally started as an idea for a world where the existence of ghosts had been proven, and a law firm that specialized in wrongful death suits. As tickled as I was by my cheesy tagline, “I sue dead people,” the idea went nowhere without a main character or a compelling story to give it life. (Besides, I know zilch about law, so it wouldn’t have gotten far. It wasn’t until the main character of 16-year-old Aura Salvatore came into the picture that the story took off. I thought hey, what if all people her age and younger could see ghosts? And then the biggest part of the story of all: what if her boyfriend died and become a ghost?

SHADE wasn’t my first attempt at writing YA, though. I wrote another YA (about the daughters of fallen angels Lucifer and Beelzebub as high school seniors) in between my other books, in bits and pieces from 2003 to 2006. But when it came time to revise it for submission in 2008, I realized it pretty much sucked (well, the first half of it, anyway). By that point, I already had the idea for SHADE and was really excited about it, so I decided to do that instead. Sometimes you just have to know when to drop a project and move on.

Having written for both adult & YA audiences, what was the hardest/easiest about writing YA?

In some ways, writing YA is easier. I get to focus on the elements of storytelling I enjoy most and that I think I’m best at: character development and voice, especially dialogue. Writing for teens usually requires a faster pace, and I’m all for that. Whether I’m writing for adults or teens, I believe in following Elmore Leonard’s #1 rule of writing: leave out the boring parts.

The hardest part of writing YA for me is cutting down on the plot digressions. Especially with a book like SHADE where the whole society has changed because of ghosts, it’s so tempting to geek out and explore all the different world-building aspects. My editor does a great job of telling me when I’m losing focus from the main characters and their conflicts. Also when I’m getting too James Bond-ish.

In Shade, the colors purple & red are significant, why were these colours chosen?

The color concept is based on the visible light spectrum—though I don't specifically mention it in the book—where violet and red lie at opposite ends. Red corresponds with the first “chakra” (or energy center, in traditional Indian medicine), located at the base of the spine, where it represents life and the physical world. Violet is associated with the seventh chakra, at the top of the head, representing pure thought. Though I’d chosen obsidian because of its use by ghost hunters, I later discovered that the rock corresponds to the color red and the first chakra. Score one happy world-building accident!

How many books are planned for this series?

There will be at least two (SHIFT is coming out next May). I hope there’ll be three or four ultimately, but of course that depends on my publisher wanting more, which of course depends on readers supporting the series. This doesn’t just apply to my books—if you love an author, buy their books and tell all your friends! Otherwise the publishers won’t know how loved they are, and next thing you know, no more books. :-(

Can you give us a sneak peak at what to expect in book #2, Shift?

SHIFT picks up right after SHADE finishes, and you won’t believe how Chapter One ends! Aura faces a whole new unimaginable dilemma in her choice between Logan and Zachary. As Zachary puts it, “We need to redefine the word ‘impossible.’”

But Aura does find out all about her mom and dad and the mystery of the Shift. The question is, what does she do with that information? And that leads us into a possible third and fourth book.

Ahhh, as if I wasn't already dying to read Shift!

Thanks so much for having me on your blogs! I love to hear from readers, so come visit me at www.jerismithready.com, or better yet on twitter @jsmithready or http://www.facebook.com/jerismithready, where I spend way too much time.

And thanks for writing amazing books & sharing them with us!
--------------------------------------------------------------------------

I hope you have enjoyed the week so far. Today is the last day to enter the contest for a SIGNED copy of Shade courtesy of Jeri! (Click here to enter)

Now for the fun interactive part...Jeri will be checking in with us today so if you have any questions for her, just type it up in a comment below!

Cross-posted at: He Followed Me Home...Can I Keep Him? on 13 May 2010.

Learning More About Logan

2010-05-12T05:12:00.000-07:00

When I had the chance to interview Aura, wouldn't you know it Logan was there too...I just couldn't see or hear him! Aura acted as a mediator for me, I had so many questions for him (but as you can see we had to cut it short). In case you haven't read Shade yet, there are two guys in Aura's life: Logan & Zachary. I must admit I was leaning more towards team Zachary when reading the book, but Logan just may have have won me over, I'm not so sure anymore!

If you could go back in time and change one thing (besides your death) what would it be?

I wish I’d played that song for Aura, the one I wrote for her. I thought there’d be another chance. I thought there’d be lots more chances for lots more things.

God, sorry, that sounds pathetic. I’m not really like that. Mostly I don’t bother with regrets. Life’s too short, y’know? Especially mine. Jeez, I’m getting worse, aren’t I? Next question?

Now that you are a spirit, what do you miss most?

Well, obviously the big loss is not being able to touch Aura. Sometimes I sit and close my eyes, try to relive what that was like. It’s like if I could just concentrate hard enough, I could conjure up the feel of her skin and hair and put that feeling back into my fingertips. I can almost get there, but not quite.

I also miss holding a guitar—in my head I still know all the chords and how to play, but so much of that is muscle memory. And I miss being able to reach everyone with my voice instead of just a few people.

And this is going to sound weird, but I miss sleep. It’s driving me crazy, never being able to turn off my brain. Well, not my brain, since that’s dead. My mind, I guess. Anyway, it’s exhausting. And boring.

What is the coolest thing you've discovered?

Once when I was a kid, my family went to Ireland on vacation. Since ghosts can go anywhere they went during their lives, I can be back in Dublin in less than a second. Watch.

*disappears, then reappears*

Freaking awesome, right? I was way too starry-eyed when I went as a kid to really notice much—a place that incredible, you just can’t take it all in, not in one measly week. So now when I go back, I check out all the little things, like the ducks in the ponds at St. Stephen’s Green. When you’re a ghost, you can sit right next to them and they don’t care. It’s pretty cool.

Another cool thing is that I can get into shows for free and listen to any band I want, as long as I’ve been to that club or whatever before, and if it’s not BlackBoxed to keep out ghosts. But any place worth going wouldn’t be able to afford BlackBoxing.

Who is your favorite band/song?

Definitely “Devil’s Dance Floor” by Flogging Molly. It’s got this insane energy—I was never so alive as when that song was playing. Our band practiced it for months before we got it right. Now when we do it onstage, I feel like a god.

I mean, I felt like a god. Sorry, I still slip up my past and present tenses sometimes. Not on purpose, swear.

What do you think of Zachary?

I thought these were all gonna be easy questions. I really have to answer this?

OK, fine. I try not to think of that guy. I can’t see him and he can’t see me, and even if we could see each other, I couldn’t pound his head into the wall like I want to. So what’s the point of thinking of him?

But I guess if Aura likes him, he can’t be a total waste. She’s a good judge of people. And if I really loved her, I should want her to move on, right? We obviously have no future. Maybe it would even help me pass on if I knew she’d be okay, if I knew she’d find happiness with a good guy, like he probably is. Right?

No. Screw that. I want to kill him.

Oops, sorry Logan! Calm down, don't go Shade on us... think of Aura!
-----------------------------------------------------------------------------------------

Along with my interview tomorrow, you will also have a chance to ask Jeri some questions!

Also, just a reminder there's a few days left to enter to win a SIGNED copy of Shade (click here)!

Cross-posted at: He Followed Me Home...Can I Keep Him? on 12 May 2010.

A Chat with Aura from SHADE

2010-05-11T05:12:00.000-07:00

Aura is the main character in Shade. Her life right now has gotten a bit weird, even for her! Not only does she lose her boyfriend to an accidental overdose & continue seeing him, she meets Zachary who has his own secrets & possibly answers about the Shift that she is eager to uncover. I had the opportunity to ask Aura a few questions, so sit back, grab your coffe & enjoy!

How long have you know you were 'special'?

It’s funny, when I was really young I didn’t know I was special. My whole life, the world has had two kinds of people: the living—who are solid and come in all colors—and ghosts, who glow in violet and are completely untouchable. In nursery school, most of my friends could see ghosts, too. I thought it was something kids could do and grownups couldn’t, like ride a tricycle or do a somersault without hurting themselves.

It wasn’t until I started playing with some of the older kids in the neighborhood (like Logan, who’s two months older) that I realized it wasn’t just grownups who couldn’t see ghosts. I think I was in kindergarten when I found out that my birthday was the same day as the Shift. Eventually I found out that it happened the minute I was born. Which was pretty freaky.

Do you believe in fate?

No. That’s depressing.

Do you appreciate being born post-Shift since it means you are able to spend more time with Logan?

Definitely. I think Logan’s death has been even harder on his older brother and sister who can’t see him—and of course on his parents. Pre-Shifters have a totally different view of ghosthood than we do. To them it’s a curse. They think it means the person’s soul is suffering, or that they’re in purgatory or something. But not all ghosts are miserable. Just ask Logan.

Now the flip side of the coin, is it harder to accept Logan is gone as he is still able to visit you in spirit?

Yes! Because he’s still him. It’s not like ghosts in books or movies where they just float around moaning (not that real ghosts don’t moan—they do, A LOT). Logan is really here, every way but physically. We still have normal conversations. In some ways we’re closer than when he was alive.

So it’s like, am I still his girlfriend? How long can we make this work? Am I the weirdest girl ever? I mean, I know he’s not coming back to life. But he still feels so real. No—he IS real, because who he is, is much more than just a body.

What's up with you and Zachary?

Good question, and honestly, I don’t know. In a lot of ways, he’s the perfect guy for me, but right now is so not the perfect time. I don’t know how long I can expect him to wait around, though, before he gives up. Because Becca’s always lurking, and even though she’s a monster, she’s a really hot, rich monster. Most guys would kill to be with her.

Thanks Aura!
-----------------------------------------------------------------------------------

Don't forget there's a chance to win a SIGNED copy of Shade courtesy of Jeri Smith-Ready! (click here)

Also, just a heads up as Thursday's post will be an interview I had with Jeri. She also offered to pop in during the day giving you, the readers, an opportunity to ask her some questions. I'm going to make this easy-peasy: when the Thursday post is up, all you need to do is ask your questions in the comments :)

Cross-posted at: He Followed Me Home...Can I Keep Him? on 11 May 2010

It's SHADE Week!

2010-05-10T06:32:00.000-07:00

I am very honored to run a week of Shade by Jeri Smith-ready! This is an amazing paranormal story that really stuck with me long after reading it.

About the book (from Jeri's blog):

Love ties them together.
Death can't tear them apart.

Best. Birthday. Ever. At least, it was supposed to be. With Logan's band playing a critical gig and Aura's plans for an intimate after-party, Aura knows it will be the most memorable night of her boyfriend's life. She never thought it would be his last.

Logan's sudden death leaves Aura devastated. He's gone.

Well, sort of.

Like everyone born after the Shift, Aura can see and hear ghosts. This mysterious ability has always been annoying, and Aura had wanted nothing more than to figure out why the Shift happened so she can undo it. But not with Logan’s violet-hued spirit still hanging around. Because dead Logan is almost as real as ever. Almost.

It doesn't help that Aura’s new friend Zachary is so understanding—and so very alive. His support means more to Aura than she cares to admit.

As Aura's relationships with the dead and the living grow ever complicated, so do her feelings for Logan and Zachary. Each holds a piece of Aura's heart…and clues to the secret of the Shift.

Look for the sequel, SHIFT, coming May 2011!

Book Trailer:

About the author:
Award-winning author Jeri Smith-Ready lives in Maryland with her husband, two cats, and the world’s goofiest greyhound.

Jeri's plans to save the earth were ruined when she realized she was more of a “problem maker” than a problem solver. To stay out of trouble, she keeps her Drama Drive strictly fictional. Her friends and family appreciate that.

When not writing, Jeri she can usually be found—well, thinking about writing, or on Twitter. Like her characters, she loves music, movies, and staying up very, very late.

...and thanks to Jeri, you have a chance to win a copy of Shade, please fill out the form below!

Loading...

Cross-posted at: He Followed Me Home...Can I keep him? on 10 May 2010.

Interview with Lindsey Leavitt

2010-05-08T06:28:00.000-07:00

You have read my review of Princess For Hire now, here’s an interview with the fabulous author Lindsey Leavitt!

Hi Lindsey! Could you tell us more about yourself first? In no more than 150 words.
Okay. Opening up my train of thought for y’all. UNEDITED. Ready?
I like the color yellow. My kids are hilarious. I think guys in scrubs are cute (particularly MY GUY in scrubs). To get Zen, I hit up the batting cages or play pepper (volleyball) or swim. I like sunshine. I hate winter. And I write.

What was your first reaction when you saw the cover for Princess For Hire?
HOLY PINKNESS. This is probably a universal reaction. I really love it, though. It’s beautiful, especially in person, and I love how it hints at magic.

What’s one of your favorite first sentences from one of your favorite books? (Borrowing question from Malinda Lo!)
“My name is India Opal Buloni, and last summer my daddy, the preacher, sent me to the store for a box of macaroni-and-cheese, some white rice, and two tomatoes and I came back with a dog.” from Because of Winn Dixie.

Why was it your favorite?
Because it let’s us know so much about Opal and the setting and her family in such a simple way. In fact, the simplicity lures us in, so that the “came back with a dog” is a delicious surprise.

In what ways was Desi similar to you?
When I was thirteen, I was at odds with who I was and who I thought people wanted me to be. So I would try to be those things (and was thus that over-eager LIKE ME! girl), when really I learned that Being Authentic was my best bet.

If someone told you 20 years ago that you would be a published author, what would your reaction be?
Oh, I wouldn’t be able to say anything. Because I was 1, of course. Maybe ma ma?

If you could meet one author, living or dead, who would it be?
There are a bunch of writers who I really admire, but I’m not sure I’d want to hang out with them. Like Tolstoy? Could be a drag.

So I’ll go with Meg Cabot, because she’s just so sparkly and real. Plus, she’s very secure in who she is as a writer and a person, and I’d hope some of that would rub off on me. And maybe I could borrow some of her clothes.

If you could go back in time and tell your 16-year-old self a piece of advice, what would it be?
OPEN YOUR EYES.

In Princess For Hire, there is a mix between fantasy and reality. Ultimately, what would you like people to take away from your book?
I’ve been told my book has a “good message”, and of course I was aware of that as I wrote it. But really? I just want it to make people happy for the couple of hours they’re reading it. Laughter is good. I hope readers close it and feel like their day is a little brighter.

Thanks for stopping by, Lindsey. Tomorrow, her protagonist, Desi will be popping in. Hope you enjoyed the interview!

A little more about Lindsey: Lindsey Leavitt grew up in Las Vegas and now lives in Alabama with her husband and three small daughters. Although she has been a substitute teacher and a homecoming princess, she has never been a substitute princess. Yet. She’s still scanning the Want Ads…

Interview with Desi from Princess For Hire!

2010-05-07T06:27:00.000-07:00

Hi Desi! Could you describe yourself in three words?
Uh… hard-working (that still counts as one word, right?), nice and… geeky. Good geeky, though. Is there a word for good geeky?

Could you share with us about your life in Idaho before you became a substitute princess?
My life in Idaho could have been like any girl’s life anywhere. I had some rough stuff happen with friends, I had some insecurities, but also a good family and other things that made me happy. Sometimes, I blamed my misfortunes on where I lived, but I see now that every girl has drama to overcome.

Of all the princess jobs you have done, which one was your favorite?
Elsa. For anyone who knows about that job, I think it’s obvious why I liked this one best.

OOH… yeah. You guys will have the book to find out why! Elsa lives in the eastern Alps and when Desi first arrived that, she wanted to do this…

Yup! The scene from The Sound of Music!

…And which job was your least favorite?
Princess Catter. Prosthetic makeup HURTS, you guys.

What was your first impression of Meredith?
Well, being as she popped out of bubble, my first impression was that she was a hallucination. Then she started talking and… okay, I like her fine now so it’s okay to say this… but I kind of thought she was rude. And snobbish. And bossy. And sassy. And… I better stop there.

You are a big fan of Audrey Hepburn. If you were given the opportunity to meet Audrey, what would you say to her?
Say? SAY? Nothing. I would be IN SHOCK. And not because she’s dead and all. Audrey Hepburn was Hollywood royalty! She was a great actress, but also a really great person who left this world better. What do you say to someone like that?

I will probably just stand there with my mouth open, awed.

If you could meet one princess, living or dead, who would it be and why?
There is a quote that may or may not have been said by Princess Diana. “Being a princess isn’t all it’s cracked up to be.” She had, like the craziest wedding day ever, and I wonder if she thought it was all rainbows and sunshine when she got hitched. When did she start to become disenchanted with the royal lifestyle? Would she still want to be a princess? I’d like to meet her, maybe for tea, and ask her all of that. I think subs could learn a lot from her trials.

Ah! One of the most famous princesses. I would love to meet her too!

Thanks for stopping by Desi! I won’t hold you up from your princess duties any longer. Have a nice day!
Thanks! I’m actually back home right now, so no princess duties. Just designing some new T-shirts. Maybe I’ll make an I <3 YA Round Up one!

Enjoyed this interview? You’ll love the one I did with Lindsey Leavitt!

5 copies of Princess For Hire to be won!

2010-05-06T06:27:00.000-07:00

When a well-dressed woman steps out of a bubble and wants to know if you’d like to become a substitute princess, do you
A) run
B) faint
C) say yes?
For Desi Bascomb, who’s been longing for some glamour in her Idaho life, the choice is a definite C). Desi has a rare ability: with the help of “Royal Rouge,” she can temporarily transform into the exact look-alike of any princess who needs her subbing services. Dream come true, right?
Well, Desi soon discovers that subbing involves a lot more than wearing a tiara and waving at cameras…. In this winning debut, one girl’s dream of glamour transforms into the desire to make a positive impact. And an impact Desi makes, one royal fiasco at a time.

Sounds good right? Well I am giving away 5 copies of Princess For Hire! Yes, FIVE shiny brand new ones. Five winners! I will draw 2 international winners and 3 US/Canada winners. However, you must be a follower/email subscriber to enter.

CLICK HERE TO ENTER!

Contest ends on 20th May 2010.

Interview with Rose from THE OWL KEEPER:

2010-04-25T13:02:00.000-07:00

First off, I have to compliment you on your name: Artemis Rose. Wow, that is definitely a show-stopper. Anyways, welcome Rose! Now to get down to business, how would you describe your first encounter with Max by the owl tree? What did you think when you saw his golden-eyed, fragile silver owl?
Hi LiLi. I like my name too, it’s very special because I’m named for the moon goddess Artemis who was strong and brave, like I am, except the real Artemis knew how to shoot arrows (but maybe one day I’ll learn how to do that too). When I very first saw Max I thought: who is this scrawny scared-looking kid wearing the weird hat with a bobble and earflaps? I knew he was upset to see me there and I thought well too bad because I go where I want in the nights and nobody can stop me.

But I also realized this kid was special, because he was out in the night, not like most people who’re afraid of the dark. Then I saw this owl up in the tree and it didn’t look too good because its wing was sticking out funny and its eye was only half-open. But its wings were all shiny and silver! Max kept saying it was some old barn owl, but I knew he was just trying to trick me.

Throughout your journey with Max, I noticed you tended to have a whole mess of adventures together. What were some of your best times during those beginning thrilling times?

Lots of our adventures were really scary and we had some pretty close getaways, so they were good and bad all at the same time. But I had fun kicking over Mrs. Crumlin’s basket of muffins and stomping on them and seeing her face go red – she was so mad! It was fun, too, trying to figure out the owl’s message and all that stuff about the prophecy. And even though I was scared out of my wits, I loved the way we left the fortress when the wolf chased us (but I’m not telling you any more about that because you have to read the book to find out what happened!)

How was life growing up with a rebellious father and having a hard time trusting anyone anywhere you were?

Both my parents were secret rebels against the High Echelon and I think that’s very cool. My father always told me to be a free spirit and to think for myself. He said it was important to trust my instincts and not believe everything people told me just because they were adults—especially if I thought they were, like, spies or worked for the High Echelon.

If it's not to painful could you tell us something you remember about your mother before she was falsely incarcerated?

I remember we were hiding out in a place called Tattersall Heath and all around were cornfields and orchards and red-gold wheat and junked tractors and there was this shut-down theme park and my mom and I walked around it and there was this ride she said was called a merry-go-round and she lifted me up on one of the painted horses and we laughed and laughed.

When you heard Max's tales about the Owl Keeper, what was your initial feeling/reaction?

I’d never heard of an Owl Keeper before and I thought Max was just making it up. I told him too bad the Owl Keeper’s not real because we could use somebody around here like that. But he kept saying the Owl Keeper was real so I told him that the Owl Keeper better hurry up and help us because things were falling apart left and right.

Most importantly, how was it that you could cope so well it seems--since you were always the tough one--with the spurts of blindness in the final journey?

Hey, did you forget my name or what? I’m Artemis, the goddess of wild things who was totally fearless and shot her enemies through the heart with arrows! I can handle anything because I’m super tough and I never, ever give up. (On the other hand, I guess you could was glad to have my friend Max along when things got really bad)

And finally, how do you feel about Max? What changed about you when you really got to know him?

Well, Max was pretty lonely and he didn’t know a lot of things because he was stuck inside his house all those years with that old biddy guardian and he was totally clueless about what was going on with the High Echelon and everything. But Max was so kind to his little owl, and that really got to me, and the more I hung out with him, the more I started to think he was kind of mysterious.

Then we ran into the forest and even though Max was scared to death he did lots of brave things and didn’t give up, and he helped me out when things got really bad. One time we thought wolves were going to get us and Max said if anything happened would I remember that we were friends. That was so cute! Like we were olden-day friends and we’d be friends forever.

Any last hoots? (Or should I say barks? Growls? Hmm...)

If you ever get a new dog, especially a shaggy black one that barks a lot, and you don’t know what to name him, then I know a great name: Helios. Helios was a sun god who drove the chariot of the sun and I can’t think of a better name for your dog.

Bye LiLi!

Cross-posted at: ChicaReader on 18 April 2010.

Character Interview with Max Unger (The Owl Keeper)

2010-04-24T09:42:00.000-07:00

I had the wonderful pleasure of interviewing Maxwell Unger from Christine Brodien-Jones' The Owl Keeper.

Look below to see what he had to hoot:

Hey Max, from the beginning to your present, how has your perception of Rose changed?

When I first saw Rose under the owl tree, looking all wild and acting kind of superior and everything, I was scared out of my wits! Rose was so bossy and annoying, and I never knew whether I could believe anything she told me. I didn’t even know if I could trust her! What if she was a spy for the High Echelon? But now, after our long scary journey together, we’re the best of friends, and I’ll do anything to protect her, just like my silver owl. I guess you could say Rose is my best friend in all the world (even if she still gets a bit bossy sometimes). I think she’s totally brave and amazing.

Have you always hated Mrs. Crumlin's cooking, and is there a dish that at least tastes slightly edible before you found out the truth?

Everything Mrs. Crumlin cooked was always burned and had a weird texture and made my stomach do flip-flops. She was always trying out these disgusting radio cook-show recipes. I guess when I was younger I sort of liked her griddlers, that is if I poured enough golden-eye treacle over them to drown out the metallic taste…

You say that you love the night, what are some basic things you like about it?

I love everything about the night: the way the dark wraps around me like a cloak, climbing the owl tree and sitting in the dark with my owl, gazing off into the forest (which can be a bit scary sometimes). I love the smells in the night, and sometimes the sound of a distant bird or animal (though, sadly, there aren’t too many left). I love the light of the two moons shining down and the way the cattails whipped at my legs and the overarching branches of trees against the sky.

What's one memory you can remember about a time when you went hiking with your gran in the woods?

When I was little I’d go tramping off into the night with my gran; back then the forest wasn’t so dangerous. My best memory is of us going deep into the forest, where I found a certain kind of fungus that glows in the dark. It was really cool and I was so excited I started jumping around and accidentally stepped on it. I started to cry, so to cheer me up, Gran told me a story about an Owl Keeper and these magical creatures, the silver owls. It was the first of many times that she told me these tales of how the owls were freed from a dark spell and about the Owl Keeper who, in times of darkness, gathered silver owls and Sages to fight the powers of evil.

How does it feel being so young and having to adjust to a fated destiny?

It’s kind of hard. Sometimes I think: why can’t I just be an everyday all-American kid hanging out with my friends after school and going to friends’ birthday parties and stuff? But I’ve always known, deep down, that I wasn’t meant to have, like, an ordinary kind of life.

Any last hoots?

I just want to say that if you’re looking for a pet, owls are the best pets in the world because they’re mysterious and loyal and they cough up owl pellets that sometimes contain interesting things.

I’m happy to meet you, LiLi, and I hope you like owls as much as I do. (:

Thanks for stopping by, Max! Pleasure to hoot with you. ;)

More about Christine and The Owl Keeper:

Website

Blog

Facebook

Twitter

Cross-posted at: ChicaReader on 15 April 2010.

Author Interview: Christine Brodien-Jones

2010-04-23T06:04:00.000-07:00

I had a chance to interview Christine this week to promote her latest release The Owl Keeper, since I'm dedicating this week to her novel.

1) What were the first aspirations you had for The Owl Keeper?

I started writing THE OWL KEEPER two months after 9/11, when the world seemed bleak and hopeless, and I think in the back of my mind I wanted to write a book about hope. I also wanted to write a book that children would love – the kind of fantasy that I loved reading as a child.

2) What first got you interested in the theme of owls in general?

Owls are night creatures, with an aura of mystery about them. In certain societies they symbolize wisdom, the ability to see things that are hidden. In others they represent good fortune, magic, sometimes even death. Owls are very powerful birds: stealthy predators that attack without warning. They’re also eerily beautiful. I loved the idea of owls with silver feathers and creating a myth around these fabled, magical creatures.

3) What's an anecdote of a fun experience you had while writing this novel?

One fun thing I did was adopt a rescue barred owl through the Adopt a Wildlife Ambassador Program at the Center for Wildlife in Cape Neddick, Maine. I chose the barred owl because she reminded me of Max’s silver owl in THE OWL KEEPER, except this owl is much bigger!

Her name is Bianca and in 1995 she was hit by a car and suffered a broken wrist. They couldn’t release her into the wild, so she lives at the center. Over the years she’s been a foster parent to other barred owlets and travels with programs to educate the public. I’m hoping to go visit Bianca this spring!

4) If--and I mean this as inoffensively as possible--The Owl Keeper wasn't published, what would you be doing right now?

I’d probably be working on another book! Or re-writing The Owl Keeper to make it better! I can’t imagine a life without writing. However, if I wasn’t writing, the next best thing would be to pack my carry-on bag and take off, ideally to Europe or South America. I’ve found that exploring different corners of the world fires up my imagination; travel is a great way to discover new ideas and delve into myth and history.

5) With all the great feedback your released novel is getting, what would you hope your next novel to exude from readers?

My next novel is very different from THE OWL KEEPER; however it still has the elements of adventure and magic and terrifying situations. The book is set in the Sahara Desert, in Morocco, and there’s a feisty young heroine who finds herself in strange and harrowing circumstances. My hope is that young readers who loved THE OWL KEEPER will enjoy this book too.

6) Any guilty pleasures outside of the writing/reading business done at home? (Eg. spending time at the park, travel)

I love listening to music and sharing good times with a few close friends, and spending time at our old country house in Deer Isle, Maine. I adore the summer when I can hike, sail, kayak and go rowing on Gloucester Harbor. Winters my husband Peter and I travel to Buenos Aires where we study Spanish and tango.

7) What are some of your favorite books that you like to go back to from time to time?

All the whimsical time-travel books by Edward Eager, including “Knight’s Castle” and “Magic by the Lake” – I devoured those as a kid and they inspired my writing; I also love the illustrations by N. M. Bodecker. Other books I read when young and still go back to: Susan Cooper’s THE DARK IS RISING series, Ursula K. LeGuin’s EARTHSEA trilogy, Tolkien’s LORD OF THE RINGS, the odd sci-fi fantasies of British author John Wyndham.

8) Now that The Owl Keeper is published, what are some of your future goals in the writing industry?

As I said earlier, I want to write books kids will love to read – books that stir their imaginations, with heroes and heroines they can identify with. I can’t think of anything more wonderful than getting books into the hands of young readers – especially reluctant ones – and having them fall in love with books and the amazing power of stories.

The short answer is: I’ll keep writing books for young people.

9) After the whole process to get The Owl Keeper out in the world, do you feel relieved? Successful? Why?

I’m amazed and thrilled, to begin with, that this book is out there at last. I feel incredibly grateful to all the people who made THE OWL KEEPER happen – and they were many! – especially my agent Stephen Fraser and my editor Krista Marino, who both loved the book and believed in it. I suppose, too, I feel a certain relief that the book is finished and out there: now I’m free to let go and move on to the next.

10) To finish things off on a light-note, how would you describe The Owl Keeper to young readers debating on picking it up?

Well I’m not sure how “light” this will be, but here goes:

Have you ever felt afraid or alone? Ever kept a secret too dangerous to tell? Max Unger, hero of THE OWL KEEPER, has always loved the night. He used to be brave, exploring the forest with his grandmother after dark. But the forest is dangerous now, his gran is gone, and Max is alone and afraid. He misses Gran's stories about the silver owls and the world before the Great Destruction. And…Max has a secret: one he doesn't dare tell.

What if you’re a kid and there are no adults you can trust? What if you find yourself in a scary place? That’s where Max finds himself at the start of this book. But Max has a hidden strength deep inside him and, when faced with impossible circumstances, he sets off on a quest that he doesn’t completely understand, taking his silver owl and friend Rose with him. THE OWL KEEPER is a quest of hope, a story of friendship. It’s also about conquering one’s darkest fears.

If you enjoy impossible quests and underdog heroes, this book is for you.

Thanks for the interview, LiLi, it’s been fun! (:

It was great to have you, Christine.

Cross-posted at: ChicaReader.

Christine Brodien-Jones on Revising Your Manuscript

2010-04-22T06:01:00.000-07:00

The “Alien Relic” That’s Your First Draft
~by Christine Brodien-Jones, author of THE OWL KEEPER

I remember being handed back a short story in high school with a B scrawled in red ink across the top of the page and the words: “Needs more work.” What was that supposed to mean? I was baffled. I’d spent at least two or three weeks working on it! I had no idea, back then, that writers revised. For me revision was a foreign concept. You wrote a story and presto! there it was, for people to read and admire. Besides, I was way too busy with other things to go back and rewrite a story I’d written for English class.

Years later, I’ve become one of those writers who looks forward to editing and revising. I love this process! In fact I have to resist the urge to rewrite every page of my novel as I’m writing it. That’s what Kurt Vonnegut used to do. His method was to revise every page until he got it exactly right and the book was a polished gem. (Somehow I don’t envision that happening with my books!)

After finishing your first draft, the smartest thing you can do is take time off. Your mind and imagination, argues Stephen King in ON WRITING, have to recycle themselves—at least in regard to what you’ve just written. Put the draft away for at least six weeks and write something else. When you finally open the drawer and see your manuscript looking like “an alien relic bought at a junk-shop or yard sale where you can hardly remember stopping,” you’re ready to tackle it again. Read through the manuscript in one sitting, if possible. This can be a “strange, often exhilarating experience, “ because it will be like reading someone else’s work: “This is the way it should be, the reason you waited,” King explains. “It’s always easier to kill someone else’s darlings than it is to kill your own.”

While reading over the manuscript, ask yourself these questions: Do the first few pages pull the reader in? Does the action flow smoothly from one chapter to the next? Is the plot compelling? What about the overarching story: have you left out important details that the reader needs? Does the ending make sense? Will it satisfy the reader? Go back and revise these major structural points.

Once the main elements of the book are established, it’s time to eliminate unnecessary details and keep the action moving. Avoid overlong descriptions, but don’t skimp on interesting details. Make the dialogue snappy. As you go through the book, paragraph by paragraph, find ways to improve your prose. Polish your sentences. Find just the right words to create strong visual images. What I’ve learned over the years is this: believe it or not, even in a novel, every word counts.

Finally, ask yourself: Do the lead characters jump off the page? Are the stakes high enough? Check the beginnings of each chapter for “hooks” and the endings for “cliffhangers.” Get rid of unnecessary scenes that don’t move the story forward. Look for inconsistencies, and words repeated too often or appearing too close to each other. Get rid of all typos and grammatical errors. Beware of overusing vague adjectives and adverbs; instead use specific terms.

Outside readers, such as trusted friends or members of a writers’ group, can be extremely valuable, offering objective viewpoints and suggestions for improvement you may not have considered.

One of most thorough revision checklists I’ve ever seen was written by author/literary agent/blogger Nathan Bransford. You can find it at: http://blog.nathanbransford.com/2009/06/revision-checklist.html. For those of you with a first draft sitting in a drawer, waiting for it to morph into an “alien relic,” I highly recommend consulting this list.

Thanks for the essay, C!

Cross-posted at: ChicaReader.

Secrets of A Cindy Society

2010-04-21T06:00:00.000-07:00

First thing: have you read The Cinderella Society? If 'Yes', please proceed. If your answer is a 'No', please hold from peeking in by cling the 'Read More' button. CONFIDENTIAL INFORMATION AHEAD.

...I saw you peeking. Just like me, I bet you have questions in your mind after reading TCS right? Like, do the Wickeds call themselves Wickeds? Here to answer some of those burning queries is Kay Cassidy herself.

What do the Wickeds call themselves, because it seems odd for them to call themselves Wickeds, unless they treat it as a status.

The Wickeds refer to themselves as the Delectae (Latin for The Chosen Ones). This clarification was added to the book during copyedits after the ARCs had already gone out. So that's one of the little nuggets you'll only find in the finished book. J

What do they call the Cindys (Cindies?), Villains and Prince Charmings? I just don't think that they have the same perception of those people as the Cindys do, yknow? :P

The Wickeds don't call them anything. If they have to refer to the Cindys, they usually do so by individual name or by simply saying "them". Giving the Cindys a group label would suggest that they are worth recognizing and that's something the Wickeds flatly refuse to do. You're either a Delectae or nothing.

How did you get those modeling and fashion tips?! Are you actually a model? I know you're a Cindy, could that be it?

LOL. I'll never tell. ;-) Actually, my mom was a model so she helped me with the scene where Jess is with Lorraine. The fashion part was thanks to a lot of research, help from author bud Melissa Walker (who is a fashion goddess), and from Bradley Bayou's fabulous The Science of Sexy (which is about fashion, not sex. Just in case anyone is wondering). I highly recommend Bayou's book for learning how to dress to flatter your figure.

Those tips are one of my favourite parts of TCS, and I'm just loving the makeover montage that's playing in my head. Will we get to read more of such events in TCS 2?

Most of the makeover stuff happens right at the beginning of a Cindy's Alpha training, in keeping with the Cinderella theme. By the time The Cinderella Society ends, most of the glitzy makeover stuff has already been taken care of. The goal is to help them find their signature style – the look that makes them feel confident and comfortable in their own skin. Once they've figured out what's right for them, the Cindys can pretty much manage that on their own. (Along with the occasional PSC to keep their skills sharp.) ;-)

How did you come up with the idea of high heels as the official 'mascot' of TCS?

With a Cinderella theme, I had to do it! J But that's mostly just for fun. The true mascot of The Cinderella Society is the butterfly. It reminds me of my favorite saying,

"Just when the caterpillar thought it's life was over;

It became a butterfly."

Sometimes you have to completely deconstruct your world to find the person you've always secretly known you could be. That's true for people just like it is for caterpillars.

Do you have any more questions for Kay? Leave it below!

Cross-posted at: Liyanaland!.

Background Check: Kay Cassidy

2010-04-20T05:59:00.000-07:00

Tell us more about your background.
I'm a former corporate gal with an MBA who decided that writing books to relive my teen years would be wa-a-y more fun. And I was right! Best. Decision. Ever.

Which characters would you like to see get together, and why? There's a catch though! You can only pick one character, and pick one more from a different author.

Fun question! Let's see… I really like Phoebe from Tera Lynn Childs' Oh. My. Gods. series. She's driven and funny and a real match for the right guy. And although she's got a great guy in the series, I think it would be fun to see her with Archer from Rachel Hawkins' Hex Hall. Major sparks.

What would your life be like if you weren't *gasp* an author?
Hmm… I have, at various points in my life, wanted to be: a CFO of a Fortune 500 company, an actress, a bacterial epidemiologist, a real estate agent, and a professor. But more than likely, I'd be doing something along the lines of my former corporate job as a leadership development specialist. (Remember that thing I said about writing being more fun? Insert reminder here. So true.)

Having read TCS, I'm glad you chose to be an author. Are you working on any new projects that you can tell us?
Right now, I'm working on the sequel to The Cinderella Society titled Cindy on a Mission. Cindy on a Mission will be a Spring 2011 release from Egmont USA. It continues Jess's adventures in the Sisterhood and deals with a major new twist in the battle against the Wickeds.

What do you think of characters having their own Twitter account to chat with readers? And can we expect one from you? :P

I think these can be super fun! I'm not a huge fan of character blogs just because I don't have time to read new blogs very often. I tend to stick to my old faves. J But characters on Twitter are totally fun. So yes, you might just see that from me down the road!

Cross-posted at: Liyanaland!.

The Kind of Cinderella Day I Wish for Every Girl (and Woman Too) by Kay Cassidy

2010-04-19T05:57:00.000-07:00

The Cinderella Society is all about being the best you can be. The Cindys live by the creed "Celebrate your strength – Embrace your future – Be extraordinary". They support each other in living that every day and we can too. Here's the kind of Cinderella Society day I wish for you:

-- To look in the mirror and like who you see

People come in all shapes and sizes. As Gaby says in The Cinderella Society, "there's no such thing as cookie cutter." Find what works for you with fashion and beauty instead of trying to look like someone else. Being comfortable in your own skin is priceless whether you're 16 or 60.

-- To have someone you care about tell you how special you are

Having someone you care about see the value in you is wonderful. But having them tell you how they feel is even sweeter. I love getting a thumbs up, don’t you? Just remember what Sarah Jane says in TCS, that the only thumbs that matter are yours.

-- To know that no matter who has you in their sights that day, someone has your back

Making sure someone has your back is something the Cindys are devoted to, whether it's watching each other's back or having the back of the Reggies who are being targeted by the Wickeds. I hope you have someone to get your back when you need it, just like you can get theirs. As Jess well knows, there is safety in numbers.

-- To know that you are capable of great things

As Jess discovers, there's a lot more to The Cinderella Society than ultimate makeovers and Sisterhood. She has to blaze her own path in life, just like we all do. And there's SO much we're capable of. The universe is just waiting for you. Can you hear it? It's saying "Okay, I'm ready. Let's take this destiny for a spin, baby!"

Cross-posted at: Liyanaland!.

The Owl Keeper Release Giveaway!

2010-04-17T09:33:00.000-07:00

Celebrating the release of Christine Brodien-Jones' novel The Owl Keeper, I am giving away an ARC of the novel and some very unique swag. Not only will the winner receive business cards, bookmarks and postcards but also a small hand-painted owl from Argentina.

Just fill out the form below to enter! Ends April 19th at midnight EST. US residents only!

Cross-posted at: ChicaReader on 13 April 2010 .

The Witchy Worries #2 Deleted Scene and Giveaway Winner!

2010-04-16T05:23:00.000-07:00

I hope you have enjoyed the week of The Witchy Worries of Abbie Adams! To end the week here is a deleted scene from Rhonda's work on book two. Thanks to Rhonda for the fun week, I look forward to sharing many more adventures with Abbie. And thanks to all those who entered the contest, the winner is announced below!

This is actually a deleted scene from Abbie 2, in which Abbie’s parents and Mrs. Drake are removing a spell from Abbie that prevents her from sharing the secret of magic with anyone. I can’t tell you why they’re doing it though...because it will ruin a big surprise.

“Okay, Abs,” said my dad, snapping open his medical bag. “I wish we could say we knew exactly how removing this spell will affect you, but since none of us, even Mrs. Drake, has ever seen it done before, we can’t really tell for sure. Don’t worry though, honey. Mrs. Drake and I went into the time warp together and did a lot of research. So, we figure we’re as up to speed as we can get, on the correct removal technique. Your old dad’s on the case here, don’t you worry.”

“I’m not worried, Daddy,” I said.

But I was.

Munch’s eyes were big and round and he wiggled behind the cushion in the easy chair.

“Good job, buddy,” said my dad, stepping over to ruffle his curls. “You stay right there till this is all over.”

“Now Abbie. We’ll need you to close your eyes and empty your mind as much as possible,” said Mrs. Drake in a soft, soothing voice.

I closed my eyes but it was hard to clear my mind because way too many things were rushing through it right then, like worrying whether it was going to hurt… and...and worrying whether it was going to hurt!!…. I took a deep breath and let it out slowly like I do in drama club when we’re doing our relaxation exercises.

“That’s good sweetheart,” whispered my mom, still stroking my hand. “Just take another deep breath like that and on the exhale, let your whole body sink into the couch.”

My dad and Mrs. Drake started to mutter then, quiet words that I couldn’t make out. It sounded like they had a lot of syllables in them. The air thickened up around me, as it if were a muggy, summer night, just before a big thunderstorm. From somewhere in the walls, a deep hum began to throb. It got louder and louder and I felt myself start to shake. A lot.

“Marley?” my mom asked worriedly, her voice trembling.

It’s okay, Tildy,” answered my dad. “We expected some physical reaction. I’ve got my eye on it.”

I shook harder and harder and then…WHAM…my head slammed back… my eyes shot open….And I discovered that I wasn’t in my own homey living room, surrounded by people who loved me.

Uh uh.

I was somewhere dark, and cold, and SCARY!!!

There were huge, creepy shadows moving toward me, and the ground where I was lying was full of jagged, sharp edges and points.

Fear shot through me.

I pushed myself up with my hands, jumped to my feet, and screamed, “Daddy!!!??”

There was a terrible, shrieking ROAR behind me, and I screamed again and leapt forward… into the arms of my dad, who came slamming out of nowhere, right in front of me. He snatched me up and swung me around the other way. A storm of blue sparkles eddied around us.

And there I was… back in our living room, standing in front of the easy chair, with a white-faced Munch staring at me, clutching his pillow to his chest.

....and the winner is......
Jennifer G.!!!!

Congrats Jen, I'm sending you an email now :)

Cross-posted at: He Followed Me Home...Can I Keep Him? on 16 April 2010.

Surprise guest, meet Tom!

2010-04-15T05:36:00.000-07:00

I had a chance to talk to Tom before he....well, you'll have to read the story ;)

What did it feel like when Abbie looked in your eyes and realized what you really were?

I don’t mind saying I was powerful lonely right up to that moment but then it was as if the front door had opened and Abbie invited me in. Crikey! That Abbie’s a grand girl. Just grand.

While living with the Adams you read many books, which book was your favorite?

By Jings, it’s a bully high school textbook Doctor Adams secured for me, called Physics: Principles with Applications. I stayed up all night with that one and learned a powerful amount. I tried and tried to tell Abbie all about it but she kept pretending she was snoring.

Being transported from the 19th century, what was the strangest thing you saw?

It gave me a terrible turn but when I first arrived in the 21st century, I got lost in a parking lot. It scared the dickens out of me because I had a hard time figuring what all those big metal things with wheels were. But I quickly deduced that they were rolling conveyances of some sort. I was just desperate to study on what made them move but since I happened to be fleeing for my life just then, I didn’t get much of a chance. And I love a microwave. Just love it. To see those cheesy, bready things Abbie calls pizza turn round and round like that. The way they start bubbling up and steaming. I’m so glad the fella who invented the microwave thought to put a window in it. That was a great notion. Wish I’d had it.

Of all your inventions, what is your favorite?

Well of course I’m only thirteen, so I haven’t invented too much of anything just yet, and blame it all, when I get back to the past, I’ll forget everything that happened to me in the 21st century so I’ll have no idea what I’m going to invent. But I’ve been doing some Google-searches on myself and it seems my assistants in my lab and I will tackle inventing a Kinetograph and a Kinetoscope. That’s the first motion picture camera and a box to view the moving pictures in! I love the movies. Did you know you can see them in all three dimensions now?! That’s some bully inventing right there.

What do you wish you invented?

Since everybody’s always clapping me on the back about inventing the light bulb, I sure enough wish I truly had! The truth is, in 1840, a British fella named Warren de la Rue invented the first electric light bulb but he used platinum coil in it so it was too costly to manufacture. In 1879, I came along and got the notion of using a long-burning carbon filament. Well, after getting the notion for about a thousand things that didn’t work so well first. I sorry to say I didn’t invent the light bulb, I only perfected it.

Who knew, I learned something new today! Thanks for popping in Tom.

(Just a reminder that the draw for a signed copy of The Witchy Worries of Abbie Adams ends tomorrow morning at 8 AM EST!)

Cross-posted at: He Followed Me Home on 15 April 2010.

An Interview With Rhonda Hayter

2010-04-14T06:48:00.001-07:00

I hope you have enjoyed the week of Witchy Worries so far! Today we have an interview with the author, Rhonda Hayter.

Tell us about the book

It’s a middle-grade novel about a fifth-grade girl who has all the same problems as any girl with a strict teacher, too much homework and a little brother who can make life difficult. But Abbie and her family all happen to be witches and so there are a lot of magical complications to her life too. And because there are certain shenanigans involving time travel, she gets to meet someone very famous from the past. So although the book is funny, I’ve snuck in a little education as well.

What was the inspiration for The Witchy Worries of Abbie Adams?

When my younger son was little, he was the most cherubic, adorable, curly-headed little sweetheart you’ve ever met...except when he wasn’t. He had a very hard time managing big feelings and he’d just melt down so that you’d hardly even recognize him. During one of these major tempests, I turned to my poor stressed husband and said, “My God. It’s like he turns into a werewolf.” And that gave me the idea for a little boy who really did turn into a werewolf when he couldn’t manage his anger. And for a sister who might have to cope with it. That was really the seed for the whole book. Oh, my son eventually grew out of the meltdowns I’m happy to say.

What was your favorite scene to write?

There’s a scene when Abbie does something she shouldn’t do and she has to face her parents when they find out. And what she learns is that even if she makes poor decisions, they’re still on her side. It doesn’t mean there won’t be consequences for her misbehavior, it just means that they love, support and understand her no matter what. It’s how I try to parent my own kids and I’m kind of embarrassed to say I wept when I wrote it and I tear up every time I read it.

You did a great job capturing the spunk, curiosity & energy of a 5th grader. How hard it was to get back into a 10 yr olds frame of mind? (It's so long ago for me!)

It’s plenty long ago for me too, believe me. But I have to confess I was able to cheat because at the time I first wrote it, I had a fifth-grader coming home telling me about what was going on at school, talking a mile a minute and sharing fifth-grade concerns with me.

If you could travel in time, where would you go?

Ah but I do travel in time—in books. And I love going back to Jane Austen’s time, and Charles Dickens...with all that elaborate, beautiful language. I’ve been trying to turn my kids onto them...but they ain’t havin’ it. Not yet anyway.

What are you working on next? Are there any plans to make this into a series?

Well I have very big plans for it. I’m on revisions for the second one, in which Abbie encounters Harriet Tubman and I’ve made a good start on the third, in which Susan B Anthony drops by. No contracts are signed yet though, so keep your fingers crossed for me.

(Don't forget there's a chance to win a signed copy - click here to enter!)
Cross-posted at: He Followed Me Home on 14 April 2010.

Meet Abbie Adams!

2010-04-13T05:43:00.000-07:00

Abbie Adams is the main character in The Witchy Worries of Abbie Adams. She is in the 5th grade and one curious little girl. Without further ado, here's my interview with Abbie! (Don't forget there's a chance to win a signed copy - click here to enter!)

What is the hardest part about being a witch?

Well, gee, I don’t want to get all poor me or anything because... well sure, I can do stuff like zap myself onto a beach in Hawaii any old time I feel like it. But just try never being able to tell your best friend about who you really are. Sometimes I even have to lie about it. To my best friend!!

Of all the spells you know, which is your favorite & what does it do?

I’ll tell you the truth, it’s one my mom hardly ever lets me use...but it’s a really sweet one that involves a little wiggling of the fingers and thinking about a dish towel. In two seconds flat, all the dishes are done and completely put away, counters cleaned and all. Am I right? Sweet? Mom only lets us use it on special occasions though. Since it’s a non-witch world we live in, she’s a big stickler about my brother and I learning to do things without magic. Sigh.
Oh. I bet you were thinking about something a little more glamorous weren’t you? But come on! Getting out of doing the dishes? You gotta admit, that’s a good one.

Can you tell us about your most embarrassing moment?

My dad says it’s not that unusual in a young witch but I have a little problem sometimes with buildup of excess magic charge in my fingertips. It drives me crazy! Just to make it extra horrible it always gets worse when I’m nervous. And I happened to be kind of nervous one day at school, when I was about to deliver my oral report on Betsy Ross...because the truth is, I didn’t really have a lot of time to do any research because all week long my brother Munch had been...well...that’s another story.
Anyway, while I was in the middle of a sweeping gesture showing how big the first flag was, a HUGE bolt of magic charge suddenly discharged from my fingertips—and it zapped my teacher Miss Linegar right on the rear end. She jumped about a mile and was looking around to see what had stung her...and I had to pretend I had no idea what had happened. That’s while I was right in the middle of trying to pretend that I had plenty of ideas about Betsy Ross..., which I unfortunately didn’t. I’m hoping I grow out of that one soon.

If you were allowed to use magic to turn yourself into anything for just one day, what would it be?

Um...I hate to seem braggy, but..well...I kinda can turn myself into anything any old time. It’s always fun but I think the most fun I ever had was when Munch and I turned ourselves into wild mustangs in Montana and joined a herd there. We spent the whole day running races against each other through the canyons.
Will you ever go back in time to visit Tom?

You know I’d like to, but I’m afraid it would make me really sad. You see when we go back in time, we’re not allowed to talk to anyone there because it would change the past. We always have to disguise ourselves as pillars or something and just watch. And just watching somebody you’re dying to hang out with...it would be awfully disappointing I think.

What would you like to be/do when you grow up?

That’s an easy one. I’m going to be an actress like my Aunt Sophie. She’s really famous and gets to be in all kinds of movies. And well... I mean here I go getting braggy again, but after Aunt Sophie saw me in my play...um, you don’t have to go telling everyone this or anything, but she said I was a born actress.

Thanks for stoppong by Abbie!

Cross-posted at: He Followed Me Home on 13 April 2010.

The Witchy Worries of Abbie Adams + Giveaway

2010-04-12T09:08:00.000-07:00

I am excited to host a week of The Witchy Worries of Abbie Adams by Rhonda Hayter. This is a super cute, middle grade book which I reviewed last week. I hope you enjoy what we have planned. To start it off, I thought you'd like to know a bit about the book & author plus a chance to win your own copy :)

The Witchy Worries of Abbie Adams

By Rhonda Hayter

Dial Books for Young Readers

Released: April 1, 2010

Synopsis

Abbie Adams is a regular eleven-year old girl with normal problems like a really strict fifth-grade teacher. (Meet Miss Linegar. Rhymes with vinegar.) She’s chronically behind in homework, forced to keep a big secret from her very best friend and hoping like heck she can remember all her lines in the drama club play. But Abbie also happens to be a witch and in addition to everything else, she has to cope with stuff like her little brother morphing into a werewolf and trying to eat his first-grade teacher...not to mention figuring out what exactly is up with her very, very peculiar cat.

About the author:

Rhonda Hayter was born in St. Jean, Quebec. She was an actress for some time, appearing in plays on tour and in New York and Los Angeles. Now, she works as a story analyst for a famous movie producer. When she and her husband found themselves with two little boys, one of whom morphed into a werewolf one day, The Witchy Worries of Abbie Adams was born. Rhonda now lives in Los Angeles with her family. This is her first book.

To learn more visit: rhondahayter.com

Cross-posted at: He Followed Me Home on 12 April 2010.

Jacqueline Houtman on Science and Fiction

2010-04-04T03:03:00.000-07:00

Jacqueline Houtman is here, once again, to talk to us about the similarities and differences between science and writing for middle graders! Take it away Jacqueline!
What do you do with a PhD in Medical Microbiology and Immunology?
Write novels for children, of course!

I came to writing middle grade novels from what some would call an unusual background. I spent most of my life thinking I was going to be a scientist. I went to school for many years and spent a lot of time in the lab in anticipation of a career in science. I earned a PhD and then switched over to freelance science writing. I wrote for scientific journals, magazines, and nonprofits. Then an educational publisher asked me to write some short fiction pieces with science content. It was so much fun to use humor and dialogue. And I could control the actions of the characters and make stuff up. That got me hooked on writing fiction.

There are a couple of things that I learned in my scientific career that have come in useful in my fiction. I can’t tell you how many science seminars I attended that started with the speaker putting up a slide of the gene they sequenced. The screen looked like this:

GTTAACCCTAATGGGGTACCATTCGATGTCGTAATCGATCCGGTTAGCT

Only completely filled up with all those letters.

The speaker may feel the need to show how much work he or she did (although these days, sequencing a gene is a lot less time-consuming). It doesn’t do much for the speaker, though, and it was usually a signal for me to start doodling in my notebook. A better seminar would start with an explanation of why they did the work, and how it fits into what we already know or what is still unknown. Sure, show me some sequences, but only if they have a context and a purpose in the story you are trying to tell me.

Similarly, in fiction, it is a good idea to know as much as you can about your characters and setting, but it’s not necessary to tell us the color of the walls in every room in the house, unless or course it’s important to the plot. Just because you know what the main character ate at each meal, there’s no need to tell us what was in every bite. Knowing all these facts makes your book deeper and richer, but if you tell us every one of these facts we will throw the book against the butternut-colored walls.

When I was coaching scientists in writing, one of the metaphors I used was the University of Wisconsin Hospital and Clinics (link: http://www.uwhealth.org/files/uwhealth/docs/pdf/mainstreet.pdf) . I’ve been going in there as a student, scientist, patient, parent, and writer for many years, and I still get lost. Since a lot of people have that problem, they decided to create “Main Street,” a path of gray flooring that serves as a focus for navigating the maze. Now I can find where I need to go, but always have to go back to Main Street if I want to go anywhere else. When writing a scholarly article or a middle grade novel, it’s always important to keep Main Street in mind. Keep your main narrative line in mind if you go out on a tangent, or your reader will get lost and disoriented.

Science writing and fiction really have a lot in common. Keep the reader interested. Make your point. Avoid unnecessary detail and random tangents. Help your readers know where the story is going and don’t let them get lost.

Simple, see? No PhD required.

Eddy shines a light

2010-04-03T02:59:00.000-07:00

The main character from Jacqueline's debut middle grade book has stopped by for a chat today!

Tell us a little about yourself.

My name is Eddy Thomas.

Is Eddy short for Edison?

I will not answer that question.

What do you like to do in your free time?

I like to build things out of stuff people throw out. You would not believe the useful items people discard. Sometimes they are not even broken. I pick them up off of the curb so they do not go into the landfill. Sometimes I fix them, or I take them apart and use the parts for other things. For example, I made a sort of alarm clock using the clock from a coffee maker that you can program to make your coffee in the morning so it is ready for you.

There are two kinds of coffee beans. Coffea arabica is generally considered to be of higher quality. Coffea canephorais also called robusta and is easier to cultivate.

What else?

I also have a collection of DVDs of science fiction and fantasy movies. I do not really like the stories because they are not real, but I like to figure out how they do the special effects. Sometimes you can find this out from the extra discs they include. The DVDs of The Lord of the Rings (Three movies directed by Peter Jackson and released in 2001, 2002, and 2003) include an especially extensive collection of features about special effects. I thought it was very interesting to see the different ways they made the hobbits look small. Many of the techniques did not even use computers. For example, forced perspective is an optical illusion that makes things closer to you seem bigger and things farther away seem smaller.

What’s your favorite food?

I am especially fond of the garlic bread my dad makes when he makes lasagna. Did you know that the smell of garlic (Allium sativum) comes from a compound called allicin? It is produced when raw garlic is cut and an enzyme converts diallyl disulphide oxide to allicin. Scientific studies have shown that allicin has several beneficial medicinal properties.

What’s on your playlist?

I like They Might Be Giants.

What else?

Nothing.

Thanks for stopping by, Edison!

Meet Jacqueline Houtman and Eddy

2010-04-02T02:59:00.000-07:00

Today Jacqueline Houtman has graciously offered to chat with me about EDDY, writing, and science! Check it out:

Eddy knows a lot of random facts. Are these things you already knew? Or did you research each fact specifically to make it fit the scene?
Some of them I knew already and if they fit the scene I would use them. Otherwise I just cruised the Internet for each fact, trying subjects that would fit until I found something fun. The Internet is a wonderful thing.

Similarly, EDDY is centered around science and inventions. What was your research process like for all of this? Did you write the book based on what you learned as a scientist? Or did you have to do a lot of research?
My training was in the biomedical sciences. Most of the biology came from things I knew already, although sometimes I had to dig a little to come up with exactly what I needed. Eddy knows a lot more than I do about electronics, computers, chemistry, and physics. Luckily, my husband is an expert, so I often went to him for ideas. He also read over the manuscript to make sure I got it right.

Why did you decided to write for Middle Graders rather than another age group?

Middle school is where you figure out who you are and where you fit in the world. I’m still trying to figure that out for myself, so MG is a natural for me. I also think that a kid on the spectrum would have a lot of challenges in middle school, which, let’s face it, was awful for everyone. Even kids who understand the unwritten social rules. Even the popular kids, although I wouldn’t know for sure, because I wasn’t one of them.

Have you ever tried to invent something? How did it turn out?
Most of my inventing is in the kitchen. I love coming up with new combinations of flavors. I make a mean vegetarian lasagna, just like Eddy’s dad.

Why did you want to write about a character similar to Thomas Edison?
I didn’t start out wanting Eddy to be like Edison. I just thought it was a cool name. I liked the idea of reversing first and last names. Then I thought about it some more. Eddy really hates his name at first, but when he starts learning about Thomas Edison, he realizes they have a lot in common and finally accepts the name. In a way he’s accepting himself.

Thanks for stopping by Jacqueline!

Just for "You"

2010-03-12T05:05:00.000-08:00

I had read somewhere (Judith's blog maybe?) that she liked to write songs about her characters..how cool is this!!! (note: you may need to turn up the volume & I have included the lyrics below).

Lyrics:

YOU

G C Am C
You said I was something else - well, it made me nervous

Lackluster lifetimes I have danced around this circus

You were hoping I would stay so I made my escape

Rattled off a few trite words and ya put it down to fate

CHORUS:

You made me high / You, you made me high / You….you….

I guess we’ll have no more weekend warrior adventures
Not in this sorrow till I get myself together
You were hoping I’d come clean, I’d admit to nothing
Rather bite off my own tongue than eat my heart out when you’re gone

CHORUS

F G
Well it’s on and on and on we go
Well it’s on and on and on we go
Well it’s on and on and on…we….go….

You said I was something else, well, it made me nervous
What if your hands can do more than scratch beneath my surface…

CHORUS
-----------------------------------------------------------------------------------------

Thanks to everyone who entered the contest...and asked a question :) Sorry we couldn't get to all the questions, but this month Judith has a blog tour going on as well! Judith was such a sport and answered many more questions asked by you guys - here are her answers...

The Skinned series is made up of 3 books. UMS, Second Skin and Skin of My Teeth. I have other projects in the works – some with paranormal creatures and some without.
I didn’t actually dedicate the book to any one person (there are many important people in my life and I didn’t want to choose between them). I thanked my family and friends and all the folks who worked hard to bring UMS to life. Thanks guys!
When I found out UMS was going to get published I celebrated for about five minutes, then I started on edits.
Kids at my school know that I have a book coming out. They’re elementary students though and most of them probably won’t be reading UMS. But I do pop into classes and talk about the writing process or editing or story beginnings, etc. That’s always a blast for me.
How much influence did Willow have? HA! If she had her way, UMS would be one line from start to finish and I’d never write again. We’d spend all day swimming at the lake, or fetching sticks or hiking in the woods, or sleeping by the fireplace...hmm…maybe she’s got the right idea.
What do I get up to at lunch time at school? Lol…..I think I know who asked that question. I write, of course! I usually hide in the back of the staff room with my laptop and iPod – the rest of the world does not exist.
How does it feel to be a debut author? Like I ate too many of those little cinnamon donuts at the Fair and then went ten rounds on the Tilt-A-Whirl. A pukefest is imminent.
What is the one comment I’d like to hear after someone has read UMS? “When’s book 2 coming out?”
Writer’s block. I don’t believe in it – I do however, admit there are times when writing is the last thing I feel like doing. Like when I have edits for example – and I’m not in that “first draft / first love” excitement faze. The writing is actually work. To get out of this slump, I have one main technique (besides eating chocolate – which threatens my skinny jeans love, and leads to extra treadmill time – AKA…not really worth it). I either watch a great movie or read a great book. That’s all I need to get inspired and get my ass back in the chair.
Love that I got kicked out of book clubs, do ya? Lol…yeah, I get myself in trouble sometimes. ;) UMS started with a “What if?”. What if paranormal creatures converged on a small town? What if there was this girl stuck in the middle of it all? What if the girl wasn’t quite human? What if yadda, yadda, yadda….. For me, my stories come from “What if? or And then what happened?

....AND THE WINNER OF THE PRIZE PACK IS Elaine Gauthier

Thanks to everyone who participated, I hope you had a fun week with Judith & Under My Skin!

Cross-posted at: He Followed Me Home...Can I Keep Him? on 12 March 2010.

Under My Skin: Mini Guide to Beasties

2010-03-11T05:18:00.000-08:00

Judith sure loves her beasties.. the poor town of Redgrave is overcome with them! I thought it would be fun to have her give you a little taste of what you'll find in Under My Skin....

Redgrave’s Beasties

As you’ve mentioned, Mel, Under My Skin (UMS) features a smorgasbord of paranormal beasties converging on one small northern Alberta town, Redgrave. Here’s the quick and dirty lowdown on the key creatures that roam the pages of my little gothic tale.

Wolven

In UMS, my main character, Eryn is a shapeshifter, part-wolven/part-human. They are born, not made. Wolven is a term I created for her species, but it’s basically the same as lycan, which is more familiar – humans shifting to wolf form. The difference between wolven and lycan is pretty great. Most wolven (with the exception of those like Eryn’s mother – those who feel more human than wolf) live the majority of their lives as wolves. That has huge impact on their human interactions; it affects their motivations and lifestyles.

I wanted to emphasise this fact, so wolven they became.

Eryn doesn’t know much about wolven strengths/weaknesses and therefore neither does the reader. But Eryn’s learning fast. ;)

Werewolves

Werewolves are very different from wolven. In the Skinned world, they are forged with dark magicks and ruled by their creator (usually a demon, vampire, or other strong supernatural being). They’re hell hounds, creatures without thought – acting on command and ruled by both their master and lunar cycles. When not killing, they rest in stasis, hiding in underground dens until the next full moon. At that time they awaken and serve the violent needs of their masters. They are filled with bloodlust. Bites do not themselves cause a human to turn. This can only be accomplished if the human is marked according to paranorm law, and then bitten. Without the mark, the bite only wounds or kills – it doesn’t spark the change.

And poor Redgrave is overrun with these nasty creatures. Yikes!

Vampires

No paranormal story is complete without a resident vamp, and Redgrave has a few in high places. Logan Gervais, the town’s chief of police, and his progeny, Wade, are taking the town, and Eryn, by storm. In the Redgrave world, vampires have the same rules as most vamp lore – they can’t be in direct sunlight, they drink human blood, and they can influence people with mind control.

Witches

There are several key witch characters in UMS. They work positive magic; their power isn’t used to harm. There are no warlocks – a witch is a witch – either male or female. However, witches rarely birth sons and when they do…look out – those boys have more than their share of power. Witches and wolven don’t get along (some pesky servitude thing from way back), so sparks are sure to fly if they’re left alone together. Maybe that’s why Wade and Eryn have such chemistry.

However, Wade is an oddity as far as vamps go. He’s the male child of a witch, and he inherited her power after he was turned. He has special abilities. He can walk in the sun, and Logan exploits this to his advantage. He thinks he has Wade under his black-nailed thumb. Humph. Too bad Wade’s developing a mind of his own.

Windigo

This creature of aboriginal lore is a shapeshifting, man-eating giant that lives in the North because its heart is made of ice. Legend has it that windigo were once human hunters who became lost in the snow and resorted to cannibalism to survive. Once they’d had a taste of human flesh, they became ravenous beasts. The more humans they eat, the bigger they get.

Luckily Alec Delacroix comes from a long line of shamans and hunters. He and his brother, Matt, manage to take down the windigo who killed their father. But will Alec be able to trust Eryn – to accept her ability to shapeshift like these crazed beasts?

Wolves

While not paranormal in any way, I did research wolf behaviour to incorporate their traits into Eryn’s character. There are many reasons my girl’s got attitude, hates authority figures, is competitive, etc. It’s in her genes, man!

Luckily, my husband’s cousin, Joe, is a Ranger working in Jasper National Park. He took this pic of a wolf he encountered while on a hike in the mountains.

Joe was also kind enough to provide me with some stats on wolves in Alberta:

Wolves in Canada, particularly in Alberta, have it pretty good compared to wolves in the U.S. They don’t have to live in sanctuaries. We have plenty of wilderness for our wolves to explore.
The largest wolves are found in the northwest (Yukon, Northern British Columbia, and Alberta). Historic range is/was all of Canada and most of North America.
Average weight is about 45kg but can get up to 80kg.
They’re believed to mate for life and have an average of 6 young.
It’s believed that the species does not have an inborn tendency to kill but rather is born with certain behaviour patterns that allow it to learn to kill (i.e. they learn to kill from their parents.)
They hunt for prey through direct scent, chance encounter, and tracking. They are quite coordinated in their attack. I recall watching a pack hunt elk. One wolf acted as a decoy and essentially chased a bunch of elk into an ambush. Others were waiting in a series of thickets.

So there you have it. A bit of “real” info on wolves and some lore behind UMS. I hope this intro into the creatures of the Skinned series was of interest. NOTE: There are still lots of creatures to make themselves known.
----------------------------------------------------------------------------------------

Now that you've had a glimpse into her world, what do you think?

Cross-posted at: He Followed Me Home...Can I Keep Him? on 11 March 2010.

Interview With Judith Graves

2010-03-10T07:46:00.000-08:00

Tell us a bit about The Skinned series. Where did the idea come from?

Skinned was a long time brewing. Between working full time as a library technician, playing in a folk-rock band, and life in general – I’d write scenes, picking away at this idea of different mythological beasties converging on one small town. After reading about a Cree creature, the Windigo, things began to fall into place, and I decided my main character would be a shapeshifter. From there – Eryn pretty much took over. ;)

There are three books: Under My Skin (UMS), Second Skin, and Skin of My Teeth.

Eryn is such a unique spelling, how do you come up with your character names?

Ah….the “y” in her name…lol…there’s actually a story to that. In an early draft of UMS, I had her name as “Erin”. She had this snarky line about how writers add “y”s to words to make them gothic – like “vampyre” for example. The line got nixed along the way, but the spelling of Eryn’s name is ever an inside joke to keep me from thinking too much of my writing. ;)

Have you ever experienced anything supernatural in your life?

If you go to the Class of 2k10 blog (www.classof2k10.com) during my book launch, you’ll hear all about a wicked little incident with a doll my aunt gave me once. Nuf said.

Did you find any characters taking on a life of their own & deviating from your outline?

Yes! You sound like you have experience with this yourself. Tell me, Mel – how the hell do you keep your characters in line? Got any tips to share? While I do find out all kinds of nifty things about the Redgrave crew as I’m writing, it would be nice if my characters would at least pretend I’m the boss.

Who was you favorite character & why?

Most of my favourite characters in the Skinned series are ones that haven’t even taken the stage yet – Sebastian / Nikko / you only get a taste of Logan in UMS. Too bad, really. But in UMS, Kate is one of my go-to girls. She’s a witch who can control time. She’s very Zen and funky. I luvs her. ;)

What were your favorite authors growing up & how have they influenced your writing?

K – I know this is a Canadian cliché, but L. M. Montgomery was my fav author when I was a teen. Anne of Green Gables – the whole Anne series – was a major obsession. When we were planning our wedding, I told my husband he had two choices – either we have a Star Trek wedding (did I mention I’m a Super Nerd?!) or an Anne theme. We got hitched in Fort Edmonton Park (dressed in period costumes, rode in a horse and buggy, etc). Now that’s love. (Although I still wonder what our pictures would have looked like if we’d boldly gone…ya know?)

You worked with the amazing illustrator,Val Cox. Can you tell us a bit about the process.

Hanging out with Val was the best. Okay, we didn’t hang – I’ve still yet to physically meet her, but we talked on the phone, emailed a ton, and formed this cool collaborative vibe. Basically I searched through UMS for visual scenes and with my 10 illo limit, I targeted areas where Val’s gothic images would best used. Then we chatted about style/character personalities/physical descriptions, etc. Together we created the finished “Eryn.” Val’s idea of the funky ponytails beat my original (and clichéd) wavy auburn locks - hands down. I ended up changing the manuscript to match. Val = so damn cool. Check out her website: www.valcox.ca

This is your debut, how many books have you written?

UMS was the first.

How long did UMS take to write?

I started jotting down ideas for UMS in 2004. Sold the book in 2008, and here it is getting published in 2010.

What your first ever book was about & do you still have it?

Since UMS was my first book, I do still have my original (handwritten) notes. I also have about 7 different version of the story saved on various disks and flash drives. Just for fun, here’s the original opening (notice it’s in third person – yup, somewhere along the line I switched the story to 1^st):

Erin McCain stood at the bedroom window. Not that there was much to see. She’d lived in the mountains her whole life. She expected the prairies to be flat.

But this was flat-flat.

Meh. I think the final draft has a much hookier intro.

-------------------------------------------------------------------------------------------------

Thanks Judith! The thought of a Star Trek wedding cracks me up!!!

Sneak Peak Under My Skin

2010-03-09T07:46:00.001-08:00

I love the opportunity to read bits not written into the book. In this scene, you'll get a glimpse of the main character, Eryn. She is such a fun, sarcastic character and the ending of the prequel really captures this.

Judith worked with the amazing illustrator and graphic designer, Val Cox. Below I've included her stunning pictures - meet Eryn, Alec and Wade!

The Prequel....

Mom and I stood in the clearing, a fine mist of fog hovered a foot off the ground, snaking through the tall grasses. The damp ground smelled fresh and inviting. A gentle breeze brought the savoury scents of the forest to us. One scent stood out above the others. In synchronism we turned our heads. A deer pranced at the edge of the woods.

Shooting me a mischievous glance, Mom raised her arms, embracing the change. Her elegant form shimmered before me. Her hair whipped around in a wind of paranorm making. Energy crackled in the air. An instant later a sleek black wolf stood in my mother’s place.

The change took me then too.

Together we charged through the grass. Black wolf and grey wolf. Mother and daughter. Wolven.

The deer bolted.

We separated, flanking the panicked creature. In wolf form the complications of my human life slipped away. No more questions, just the thrill of the hunt. I was strong.

Invincible.

A different scent lit the air. Ignoring the black wolf’s sharp cry, I darted after the more intense lure.

A snarl. A lunge. A bite.

I feasted as if I’d never had a fresh kill before.

“Eryn, what have you done?” Mom, returned to her human form, stared down at me, horrified. Her beautiful porcelain skin paled to a chalky white, her delicate features twisted into a grimace. The revulsion in her eyes gutted me as if she’d swiped a claw across my belly.

I glanced down at the earth. At the bloodstained shoe that remained. A human. I had attacked a human. My stomach rolled.

“Help me!” I tried to scream, but in wolf form I couldn’t sound out the words.

Mom backed away, shaking her head.

I ran to her, not fast enough to reach her side.

She slipped into the mist.

Leaving me and the beast that had slipped over me like a second skin.

I woke on a strangled sob. My teeth throbbed in my mouth. The coppery taste of blood lingered. The hum of an old-fashioned slide projector brought me back to the present.

Someone had flicked on the lights.

“That was must have been some daydream,” Mrs. Stantial said over the snickers of the entire art history class. “Are you alright, Eryn?”

I stared blankly into her concerned, I-bet-this-kid-needs-therapy eyes and let out a jerky breath.

“Oh, I’m just peachy.”

Under My Skin by Judith Graves: Contest!

2010-03-08T07:18:00.000-08:00

I am excited to host a week of Under My Skin by Judith Graves. I've had so much fun working with Judith on this and am so excited for her and her debut which is released later this month, March 27th. I hope you enjoy what we have planned.

About the book:

All her parents wanted was for Eryn to live a normal life...

The town of Redgrave had had its share of monsters before Eryn moved to town. Mauled pets and missing children. The Delacroix family is taking the blame, but Eryn knows the truth. Something stalks the night. Wade, the police chief's son and Regrave High's resident hottie, warns her the Delacroix are dangerous. But then so is Eryn--in fact, she's lethal.

But Eryn can't help falling for one of the Delacroix boys, dark, brooding, human Alec. And then it all goes bad.

A normal life? That's the real fairytale.

Book Trailer:

About the author:

Judith reads as much as she writes, devouring at least two books a week. She loves heated debates over character motives...she's been kicked out of several book clubs for just this reason. With her faithful sidekick at her feet--that'd be, Willow, a yellow lab--Judith remains unfazed by book club drama and is furiously writing more paranormal stories. Which hopefully, you'll read.

Working in a school library, Judith is surrounded by children's and young adult literature (there's no escape!). She fosters the joy of reading in students and staff at her school. She helps out with the school choir and drama club. If it has to do with words or music, Judith is around. A singer/songwriter for more than 10 years, Judith often writes songs about her characters--since they are beasties of the night, this makes for interesting listening.

www.judithgraves.com/

And now for the fun part. Thanks to the great people at Leap Books and Judith, one winner has the chance to win a cool prize pack:

an ARC of Under My Skin

a bookmark

a set of character cards

necklace

Loading...

Ever seen a character diss the author?!

2010-03-05T08:05:00.000-08:00

I kid, I kid.

Today I have the great pleasure of bringing you an exclusive interview with Kent Fuller, one of the many great characters (and can I say my favorite) from Lauren Oliver's Before I Fall.

First off, please tell us a little about you.

Sure thing. Let’s see. My name’s Kent McFuller and I’m a senior at Thomas Jefferson. I’m the editor-in-chief and founder of The Tribulation, the school humor newspaper. My dream is to write for The Onion one day, or maybe the Daily Show. (I’m man enough to say it: I love you, Jon Stewart.) My favorite book is Catch-22. When my grandfather died he left me this old-school bowler hat in his will. It’s my favorite possession.

What can you tell us about your role in Before I Fall?

I’m the Dashing and Incredibly Studly Romantic Hero, of course. Well, okay, maybe not exactly dashing or studly, but I think I end up being a romantic hero anyway, at least for part of the book.

What was your favorite part or scene of the book? Or maybe is there a favourite line(s) you had that you want to share?

Do you even have to ask? I get to kiss Sam in this book. I’ve been dreaming about kissing her since I was, like, four years old.

Overall, how do you think Lauren Oliver handled your story?

To be honest? Five out of ten. I’ll give her some props for the conversations I got to have with Sam (and did I mention the kissing?) but I have some major issues with the overall arc of the book.

Is there was a scene that you could have done differently from how Lauren wrote it, what would it be & how would it be different?

I think she should have gotten rid of Rob way earlier in the book, obviously. And I have serious beef with the ending. I mean, really? I didn’t speak to Lauren for months. And, you know, if it were up to me I would have been kissing Sam on every single page.

Which character in the story would you most like to have a drink with and why?

Sam’s always carting around a Dunkin Donuts cup. I’d like to surprise her with a cup of coffee the way she likes it—large Hazelnut, no sugar, extra cream—somewhere crazy and romantic, like at the top of the Eiffel Tower. I’m not even sure if they have DD in Paris, but still.

If you could meet any character from another book, who would it be and why?
Probably Legolas, from Lord of the Rings, just because, you know--who knew elves could be so badass? According to Keebler, most of them spend all their time baking chocolate chip cookies. (And yeah, I know, I’m a nerd. Sam used to tell me that all the time; I’m over it.)

Thanks Kent for stopping by! I loved getting to know a little bit more about you. For those that want to know more be sure to pick up a copy of Before I Fall.

Falling back in time with Sam

2010-03-03T07:07:00.000-08:00

Today please welcome Sam from Lauren Oliver's Before I Fall. She was kind enough to answer some questions for me and I hope that you enjoy reading her answers.

First off, please tell us a little about you.

Um, okay. What do you want to know? My name’s Samantha Kingston but everyone calls me Sam, and I’m a senior at Thomas Jefferson in Ridgeview, Connecticut. I’m 5’8”, and I have brown hair and green eyes. I like broccoli but I hate asparagus. My favorite soda is Dr. Pepper and the smell of Red Bull makes me sick. When I was five I fell off the jungle gym at school, and I still have a scar on my knee. Is that good enough for you?

What can you tell us about your role in Before I Fall?

Well, I mean, the whole book is kind of about me, so…

What was your favorite part or scene of the book? Or maybe is there a favourite line(s) you had that you want to share?

It’s crazy. I never would have thought at the beginning of the book I would say this, but my favorite part is definitely where I get to kiss Kent McFuller.

Overall, how do you think Lauren Oliver handled your story?

Other than having some serious problems with the ending, I think she did an okay job.

If there was a scene that you could have done differently from how Before I Fall wrote it, what would it be & how would it be different?

Lauren told me I wasn’t allowed to give away any spoilers, so I can’t really talk about the ending, but I obviously wished it could have been different. In some ways I get it, though. It took me a long time—in fact, it took me the whole book—to understand why things had to end the way they did. So I guess I just wished she could have had me kissing Kent earlier. I should have dumped Rob on, like, Day Two.

Which character in the story would you most like to have a drink with and why? Would you meet for coffee/tea or perhaps for a pint at the local pub? Is there any place in particular that you had in mind for this meeting? (For example: Harry Potter might meet with Ron Weasley over at the The Three Broomsticks for some Butterbeer because they are best mates. Or maybe Malfoy would lure Harry to The Hogs Head in order to slip something into his drink so Slytherin would win the upcoming quiddich match against Gryffindor)

I would meet Lindsay, Elody, and Ally for mango margaritas at Rosalita’s. They never card us there.

If you could meet any character from another book, who would it be and why?

Lindsay’s always saying that she wants to meet the characters from the Gossip Girls series, because they know how to throw down. I bet they’d invite us to some good parties in the city.

Thanks Sam for stopping by! I loved getting to know a little bit more about you. For those that want to know more be sure to pick up a copy of Before I Fall.

Talking to Lauren Oliver

2010-03-02T06:24:00.000-08:00

Today I am pleased to welcome Lauren Oliver to Ticket to Anywhere and to YA Roundup. Lauren is the author of Before I Fall which is available now in stores.

First off…tell us a little about you?

I grew up in Chappaqua, a small town in Westchester, New York (very similar to the fictional town of Ridgeview, the setting for Before I Fall.) I was very creative—and extremely melodramatic—as a kid. Actually, I pretty much haven’t changed at all!

My parents are really cultural enthusiasts and our house was full of art and books and music. I was always dancing in the living room, or putting on plays with my older sister (one spectacularly ill-fated production of Les Miserables comes to mind), and drawing or messing around with clay. I don’t remember when, specifically, I “wanted” to be a writer. My father is a writer and I grew up seeing him write every day, so for me writing was just something you did. It was a normal part of everyday life. You woke up, you brushed your teeth, you ate, you wrote.

I remember finishing my first “novel” when I was in fourth grade. It was, like, thirty hand-written pages and I’d worked on it for a month. I remember fantasizing about what the critics would say when they reviewed it. I had serious delusions of grandeur.

What is your writing process like?

My writing process is really inconsistent. For example, today I did all my writing in an airport. Yesterday I did all my writing on the subway, typing on my phone! When I’m home I like to sit at my dining room table so that I’m extremely close to the coffee machine (easy refills!). And sometimes I like to go to cafes for a change. My favorite café of all time to write in is called Arabica. Their coffee is strong and hot, their toast is delicious, the space is sunny and warm. Unfortunately, it’s in Portland, Maine, which makes the commute somewhat problematic from my house in Brooklyn. I usually type on my computer but sometimes, when I’m stuck, I switch to writing long-hand. I write in Moleskin notebooks pretty much exclusively. They are so worth the hype.

What’s the best advice you have received about writing?

Two pieces of advice. Aim for truth, and beauty will follow. Aim for beauty, and truth will not necessarily follow. And: Write every day.

When you finish a book who reads it first?

My agent, Stephen Barbara. Occasionally I show little portions of my books-in-progress (3-5 pages) to friends, but very rarely.

What’s your most embarrassing childhood memory?

Yeesh. I have no idea. To be honest, I’ve probably successfully repressed my most embarrassing childhood memory. I threw up once in the cafeteria in first grade after eating a banana. That was pretty embarrassing. And I still despise bananas. I don’t even like to look at them.

If it makes you feel any better I did something similar in the second grade. Public vomiting in class. Wasn't fun and so I can understand the trauma!

What was your worst subject in school? Your best?

To be honest, I was a pretty solid student all around (read: I am a nerd). But actually, in high school I took Introduction to Photography and just bombed. I think I almost failed, even though it was a notoriously easy class. I just, like, cannot take good pictures.

What was your first job?

I babysat all through high school, but my first real and official job was as a lifeguard at the local Swim and Tennis club. It was awesome. We basically just tanned all day, then broke into the pool at night to go night swimming.

What’s your idea of the best meal ever? What sort of foods do you like to eat when you are sick?

Wow. I am a HUGE foodie so that is a difficult question. I literally live to eat. The best meal ever definitely involves freshly baked bread, and butter, and food you can eat with your hands: mussels in a pot, corn, lobster. Something like that. It also involves delicious wine, really good friends, and outdoor dining. Pasta is my biggest comfort food. I eat it when I’m sick, and tired….and happy and excited, for that matter! Yum, yum. I wish I had some now!
Mmm....pasta...I think I know what I'll be having for dinner tonight. lol

What’s something that made you laugh out loud today?

I caught myself dancing, in public, to Halo by Beyonce, and then burst out laughing. I’m sure everyone thought I was insane.

Well you are insane...but isn't that why we love you? =) And I am so going to have to get you to reenact this next time we meet up in NYC and document it on video.

If you were stranded on a desert island, who would you want for company?

Oh, wow. Somebody with excellent survival skills. Probably my sister. She’s small, but she’s scrappy and self-sufficient. Although, she would probably kill me after about five minutes, so maybe that’s a bad idea.

What would your readers be most surprised to learn about you?

I have a paralyzing phobia of worms.

I feel the same way about spiders. *shudders*

If we were able to take a peek at your nightstand, what book(s) might we find there?

I keep an ever-rotating selection on my nightstand. Right now you’d find A Brave New World, The Spiderwick Chronicles, Let The Right One In (an awesome Swedish vampire book), and a copy of my book! (But not because I’m re-reading. An awesome blogger in Spain illustrated a copy for me and I was recently checking out her illustrations before bed.)

I've never heard of Let the Right One in...but Swedish vampires? That definitely sounds interesting. And for those interested in checking out some of those illustrations check out Lauren's blog post about it here. Although I'm not so sure I believe her on the not re-reading based on this photo

There's some serious book love going on there Lauren! lol

What is the book that you most want to read again for the first time?

That is a fabulous question. The Great Gatsby, probably. It’s just such an impeccable, beautiful, revelation of a book: and the last line! Even re-reading it takes my head off. To be able to discover that again for the first time would be pretty much a religious experience for me.

Don't hate me but I don't think that I ever actually finished reading The Great Gatsby. I know that I somehow managed to write a report on it for school but it was...well....um....slightly fabricated and supplemented by library research. Please don't rat me out to my old teachers!

Are there any books that you might have lied about reading (we promise we won’t judge)?

Ha. Yes. I’ve lied about reading Lolita. I tried to make it through that book so many times and never succeeded; I always stop at around page sixty. It is my dirtiest, most shameful secret (so thanks for forcing me to air my dirty laundry). Weirdly, I do love Nabokov. I am now relishing in a collection of his short stories. I just can’t get into that book.

What’s a book you’ve been a book bully for. (ie one you’ve liked so much that you practically beat people over the head just to get them to read it)

A nonfiction book called Proust Was a Neuroscientist, and One Hundred Years of Solitude, by Gabriel Garci Marquez. Also His Dark Materials, by Phillip Pullman, and the Tale of Despereaux, by Kate DiCamillo.

If you could meet any character from another book, who would it be and why?

Honestly, I’d probably choose Mr. Darcy, so I could steal him away from Elizabeth Bennett. He’s so crush-worthy!

Mr Darcy is total crush-worthy! And, just for the record, he's mine so back off. lol

When you write, which comes first title, plot or character(s)?

Definitely characters. Plot is difficult for me; I really have to struggle to generate workable, viable plots. And titles are next to impossible for me. I almost always title books after they’re completed.

Which of your characters is most like you?

Hmm. I think each of my characters probably has elements of me. I relate to Sam’s fierce dependence on her friends, and her struggles to generate a meaningful sense of self. I relate to Lindsay’s fearfulness, and her tendency to conceal that fear behind bravado and arrogance. Like Ally, I’m obsessed with cooking and still dream of having my own cooking show. And I relate to some of Elody’s insecurities, and the way she tries to escape them.

If you had to do it all over again, would you change anything in your book (without being spoilery of course)?

Ha. I’d probably change a lot of little things: turns-of-phrase, sentences, images. But nothing major, no.

Which do you like better: cats or dogs? Unicorns or zombies?

Big, slobbery dogs that can fend off zombies, of course.

Speaking of zombies…the Zombie Apocalypse has started, what is your zombie plan? And if you could have one of your characters assist you in the fight against the undead…who would it be and why?

I would probably have Rob assist me in my fight with the undead, because I wouldn’t at all mind sacrificing him to a zombie. In fact, I might enjoy watching a zombie slurp out his brains! In terms of a zombie plan…I’ve been taking kickboxing classes for six months, so I’m pretty confident I could kick some undead butt.

Can you share a little of your current work with us?

Yes! I’m very excited about it. It’s a dystopian book called Delirium. It takes place in a kind of alternate history of the United States. Love has been diagnosed as a contagious disease, and scientists have developed a cure for it. I won’t say a ton about it, but it’s big and romantic and there’s a Romeo-and-Juliet element to it, and I’m super, super excited about it.

You aren't the only one!! I can't wait to read this book!

Do you have anything specific that you want to say to your readers?

Thank you, thank you, thank you. And please keep reading. That pretty much summarizes it.

Thanks Lauren for taking the time to answer questions. And thanks to all of you for stopping buy today. Also if you haven't picked up a copy of Before I Fall yet be sure to do it the next time you are at the bookstore. Its filled with some of the most brilliant writing I've read in a long time.

L to R: Tiffany, Sharon, Lauren and me.

Aiden Think So (Get it?)

2010-02-26T05:14:00.000-08:00

As a part of The Naughty List week, I have an interview with Aiden. He's the boyfriend of Tessa (the main character) and also a star basketball player. He also likes to paint nails, but he won't tell you that.

1) As suggested by Erica: what do you think of everyone calling the cheerleaders Sex Kittens? Especially calling Tessa that?
*laughs. I’ll be honest, I think it’s kinda funny. I mean, Sex Kittens cheering for the Wildcats? It’s freakin’ brilliant. And hey, if dudes want to call my girl a Sex Kitten, they can have at it. In the end, I’m the one she’s cheering for.

2) Also as suggested by Erica: why do you enjoy painting nails so much? You just...do?
I have no idea what you’re talking about. Did Tessa tell you about that?

3) She might have. What's your favorite date you've gone on with Tessa?
Oh, man. We’re talking years of history. Hm… I’m sure she wouldn’t agree, but there was this one time we were driving home after an away game and I wanted to go through the Taco Bell drive thru. Then my engine died! It was nine o’clock on a Sunday in another town and it took nearly two hours for the tow truck to get there. We ate burritos sitting on the roof of my Jetta, looking at the stars.

4) What do you like to do when you're not hanging with Tessa or playing basketball?
Hell, what is there to do without Tessa or basketball? I definitely workout whenever I can. I have a scholarship for next year, so I need to stay in shape. I do occasionally throw a raging party though.

5) What are your thoughts on Valentine's Day?
Shoot, Tessa would tell you that everyday with me is Valentine’s. Naw, I’m just playing around. I don’t know, I guess it’s cool. I don’t buy Tessa stuff though. I usually take her out, be all romantic and shit.

2010-02-25T05:18:00.000-08:00

Fiona is the narrator of the awesome, super funny new book A Match Made in High School. I'll let goodreads tell you a little bit about what happens to her in the book:

When the principal announces that every senior must participate in a mandatory year-long Marriage Education program, Fiona Sheehan believes that her life can’t get any worse. Then she marries her “husband”: Jerky jock Todd, whose cheerleader girlfriend, Amanda, has had it in for Fiona since day one of second grade. Even worse? Amanda is paired with Fiona’s long-term crush, Gabe. At least Fiona is doing better than her best friend, Marcie, who is paired up with the very quiet, very mysterious Johnny Mercer. Pranks, fights, misunderstandings, and reconciliations ensue in an almost Shakespearean comedy of errors about mistaken first impressions, convoluted coupling, and hidden crushes.

---
Fiona is totally cool, so I had to ask her a few questions:

1) Best and worst things about babysitting?

Best thing: International Corn and movies. Worst thing? Their house is so perfect that I'm afraid to even let a burp loose in there.

2) How did you get to be so good at pranking people?

I always sucked at it! But Todd quickly became an unrelenting inspiration for evil.

3) I kind of love that you and Sam watch Sixteen Candles. Obviously you both have good taste. Any other favorites movies?

Uh, yeah. Okay, I confess to a couple of guilty pleasures like Bridget Jones and Pride and Prejudice (either version), but I also love classics like Sid and Nancy and The Commitments. Roid Sally Roid!

Is it bad that I haven't seen any of those?

4) What is the most truly tacky thing you have seen/encountered recently?

I saw this girl use the end of her designer sunglasses to dig some kind of monster wax clog out of her right ear. She flicked it, too. She totally picked it, rolled it, and flicked it. That's what they call the NOCD trifecta.

That's a really horrific mental image. Thanks.

5) What is one thing you will never do?

Skinny dip. Gross. At the very least there'd better be a fabric barrier of some kind between my genitals and the nasty water where everyone else's cootches and danglies are bobbing around.

Smitten with Tessa

2010-02-24T05:11:00.000-08:00

As a part of The Naughty List week, I have an interview with the fab main character, Tessa. She's the head cheerleader and the head of SOS, a secret group of cheerleaders who also investigate maybe-cheating boyfriends.

She's totally fun, and without further ado, here is her interview:

1) How do you find time for cheerleading, school, your boyfriend, your friends, family and your *cough* missions? Do you feel a lot of pressure?
Pressure only makes me strive harder. If I crumble, my squad comes with me. So sometimes, to deal with the stress, I meditate. Or sneak in my boyfriend’s window.

2) What do you never leave the house without?
Nail polish. *giggle*

3) What's with the giggle, Tessa? ;P When did you start using the phrase "strawberry smoothie" and others like it? Which phrase is your favorite?
Since I was in seventh grade I have been working toward improving the image of cheerleaders. I think we should be a positive influence of school spirit! So I cut out the swearing and instead chose more appropriate terms. Now, strawberry smoothie is mostly for my boyfriend—and totally my favorite. Aiden is smooth. And strawberries are yummy. Enough said.

4) What's your favorite date Aiden has taken you on?
It was actually this time last year when I had the flu. It was awful! But Aiden showed up at my house (my parents were out playing a gig in Seattle) with a fuzzy new bathrobe for me, a hot water bottle, and huge pot of soup—THAT HE MADE HIMSELF. Of course it was disgusting, but it didn’t stop me from trying to eat it. Eventually we ended up on the couch watching a documentary about the solar system while he rubbed my feet. He’s completely considerate.

5) What are your favorite things RIGHT NOW?
I love reading—especially good mysteries. I also love vanilla frappucinos, pink champagne nail polish and a really sturdy bobbie pin. Um… for my hair!

An Interview with Suzanne Young

2010-02-22T05:08:00.000-08:00

Today, to kick off a week of posts dedicated to the awesome book The Naughty List , I have a post with the strawberry smoothie (that adjective will make sense once you read the book) author, Suzanne Young. Here's a description of the book, straight from goodreads:

As if being a purrfect cheerleader isn’t enough responsibility!

Tessa Crimson’s the sweet and spunky leader of the SOS (Society of Smitten Kittens), a cheer squad–turned–spy society dedicated to bringing dastardly boyfriends to justice, one cheater at a time. Boyfriend-busting wouldn’t be so bad . . . except that so far, every suspect on the Naughty List has been proven 100% guilty!

When Tessa’s own boyfriend shows up on the List, she turns her sleuthing skills on him. Is Aiden just as naughty as all the rest, or will Tessa’s sneaky ways end in catastrophe?

The Naughty List. Is your boyfriend on it?

And now, the interview:

1) Have you ever investigated someone's maybe-cheating boyfriend? Or done anything super ninja-like, like Tessa? Fess up.
Do you mean, have I ever gone through a boyfriend’s wallet, followed his car through a neighborhood and then break into his house to see if a girl was in his room? Nope. Never did that.

2) Sure. ;) What is the biggest thing you and Tessa have in common? Thing you don't have in common?
I think we both like to make people happy. I’m definitely guilty of the smiling through the sadness stuff. But I totally swear. A lot.

3) Why did you decide to have Tessa use food names instead of curse words? And how long did it take you to come up with strawberry smoothie? :D
You know, I’m not sure when the non-cursing started. It might have been with Strawberry Smoothie. I thought, what’s a really cute way to say her relationship is smooth? Wait! She loves smoothies! It sort of went crazy from there.

4) If you were a spy, what would be your number one gadget of choice?
Definitely a listening device. Hearing people’s conversations would be so fascinating. You’d learn a lot about them. Maybe some things you wouldn’t want to know.

5) How did you get started writing YA?
I’ve always written short stories, generally with MC’s that were college age. When I started writing my first full-length novel, I wanted her to be a senior in high school. From there, I realized I was writing YA. I’m not sure I have a voice for anything else. I just love the pacing of YA.

An Interview with Kristin Walker

2010-02-17T05:16:00.000-08:00

Kristin Walker is the hilarious author of the recently released A Match Made in High School. My review will be up tomorrow, but let me just say that I loved it and laughed throughout the whole thing.

Here's a description straight from goodreads, in case you need it:

When the principal announces that every senior must participate in a mandatory year-long Marriage Education program, Fiona Sheehan believes that her life can’t get any worse. Then she marries her “husband”: Jerky jock Todd, whose cheerleader girlfriend, Amanda, has had it in for Fiona since day one of second grade. Even worse? Amanda is paired with Fiona’s long-term crush, Gabe. At least Fiona is doing better than her best friend, Marcie, who is paired up with the very quiet, very mysterious Johnny Mercer. Pranks, fights, misunderstandings, and reconciliations ensue in an almost Shakespearean comedy of errors about mistaken first impressions, convoluted coupling, and hidden crushes.

---

And here's the awesome interview:

1) Your book is HILARIO. Was there ever a time where there were unfunny things in the book? How did you decide what was funny and what was just lame so you could get rid of the lame stuff?

First of all, I'd like to officially lay claim to having coined the word "hilario." I only have rock-solid proof back to July 2008, but I know it was earlier, and I'm sure it was me. I remember distinctly being too lazy to finish the whole word. But I can't imagine how it spread. Hold on, I did use it in an email to Mandy Hubbard around that time, and we all know how that girl can talk. Luckily, most of what she says is super-smart though, so when she talks, I generally take notes. Of course there's always the chance I accidentally stole hilario through cryptomnesia, which apparently is a real thing. Who knew?

And B. Sure, there were many times un-funny things were happening. Some of them needed to happen, lots of them got the axe. The one thing I never did was sacrifice a joke, though. If I thought there was anything mildly amusing about a passage, I did everything I could to "make it work." *bows in silent reverence to Tim Gunn*

Actually, I think some jokey bits did get cut in the first revision I did for Razorbill, but I made up more. And I can always recycle the scraps of funny.

2) How did you come up with the genius pranks in the book? Are you some sort of evil mastermind?

Yes, well, I am a genius and a mastermind, thank you for noticing. Did my giant, bulbous forehead give me away?

Okay, no. You know what's great about writing, though? You can take like three days to think up the best come-back for someone and then bam! put it in the scene like it was a spontaneous burst of brilliance. You never have to say, Oh man, I wish I'd thought to say that! Your adversary will politely wait as long as it takes for you to pen the perfect zinger and rip him back.

3) Did you have some awful fake-marriage experience in high school that inspired this book, or was it something you heard about and wanted to write about?

No, no experience in high school like that. The idea came to me and I said, well I know a bit about marriage, being married and all. So I went online and searched to see if marriage education is even a thing, and guess what? It IS. There are programs schools can buy. But I made all the "Trying the Knot" stuff up.

4) What would you hate the most about being fake-married to someone?

Definitely the doing things together outside of school, like a job or an activity. When the familiar, shared environment of school isn't there, things get really weird.

5) My favorite scenes to read were the ones with both Todd and Fiona involved because hilarious shenanigans would always ensue. What were your favorite scenes to write and why?

I loved working on the dance scene. It took me a long time to come up with that prank. In fact, I think it started out as something not quite as humiliating, but it got ratcheted up a few notches in later drafts. I would never, ever have had the cojones to do what Fiona did, though. So it was really fun to make her do it!

Last but not least, Kaylie stopped by!

2010-02-12T05:41:00.000-08:00

1. Did you every suspect anything weird having to do with Lucy?

A little, especially after a while. I mostly thought that her mom was sick – I never suspected that the house was the way it was. I wish she would have told me though – it wasn’t her fault. She lives with us now, so that was one good thing to come out of it.

2. What is your favorite thing about your friends?

That they’ve known me for a long time and I don’t have to explain everything to them.

3. What is your opinion on the whole Josh/Lucy situation?

I think they were destined for each other.

4. If you could change anything about your life, what would it be?

That I could get a boyfriend as good as Josh.

Crossposted at: Zoe's Book Reviews

I tracked down Josh!!!!

2010-02-11T06:00:00.000-08:00

Well since Lucy didn't say too much about Josh yesterday, I decided to track him down myself! Here's a snippet of our conversation...

1. When did you first notice/become interested in Lucy?

I noticed her right when she came to our school. It just took a long time to do anything about it.

2. Before you two started dating, had you known she had a crush on you?

No. Maybe.

3. How is Lucy?

Awesome. Can’t say more ;)

4. So, since this book is now out… what do you think of it?

It’s weird knowing what Lucy was thinking that whole time. Makes me feel bad that I couldn’t help her more, but she wouldn’t have let me. I think she’s really brave.

Crossposted at: Zoe's Book Reviews

Catching Up With Lucy

2010-02-10T06:45:00.000-08:00

I had the chance to chat with Lucy, the main character in C.J. Omololu's debut novel Dirty Little Secrets. Check out how she's doing now.

1. What was it like having a mom as a hoarder?

For a long time, I didn’t think about it too much. When I started spending the night at friend’s houses, I got that things weren’t normal at home. I always felt that I couldn’t have good friends
because they might find out about Mom. As hard as things got, I still loved her. She was my mom.

2. If you could tell your mother one more thing, what would it be?

That as bad as things got, I know that she didn’t do it on purpose. She couldn’t help it.

3. Has your relationship with your siblings changed?

They’re not around much because they’re so much older. I still see Phil, but not so much Sara. I always get the feeling that she has some suspicions about what happened, but I don’t think she’ll ever ask me about it.

4. How is Josh?

Awesome. Can’t say more ;)

5. What is it like having your story out there in the world?

It’s good and hard at the same time. It actually wasn’t as bad as I thought it would be – most people are really supportive. It’s funny, but since I “came out” about the hoarding, there are SO many other people who have similar stories.

Crossposted at: Zoe's Book Reviews

An Interview With C.J. Omolou

2010-02-09T05:47:00.000-08:00

I recently had the opportunity to interview C.J. Omololu, author of Dirty Little Secrets.

1. Who is your favorite character in the book?
Tough one. I think I have to say Lucy, mostly because it is in first person so I really got into her head. In a strange way, I began to understand how her mom’s mind worked, although I can’t say I liked her in the end.

2. Do you watch the show Hoarders? Do you think there is a difference between the hoarding Lucy’s mother does and the hoarding in the show?
I TIVO every episode, and I’ve gotten most of my extended family into it too. The show didn’t exist until well after we were done with the book, so the timing is really interesting. Some of the episodes show animal hoarding, which we consciously didn’t include in the book – most experts consider that a subset of true compulsive hoarding. The hoarders who have severe psychological disorders where they cannot part with anything, even garbage, are universally similar in what they keep and how they act. Almost every episode I see something that is in the book. In one episode, the hoarding mom actually says that the house is her “dirty little secret”. I almost fell off my chair.

3. Which age group do you prefer writing for?
I love love love writing for teens. I have a picture book that is published and I may do a few more, but for sheer enjoyment on all levels it’s YA.

4. Was it hard writing a book about hoarding?
It was very emotional. I had to really understand both Lucy and her mom, and to do that I did a lot of research. Three women who had grown up in hoarded homes helped me with all of the details so that I could get every little thing right. I’ve had a few people involved with hoarding read it and had very positive responses from them.

5. Who is your favorite author and what is your favorite book?
I hate answering that because it changes so often depending on my mood. For adult writers, I love Muriel Spark, especially her short stories. There are so many YA writers who are amazing that I love – John Green, Justine Larbalastier, e. lockhart, Sarah Dessen, Ingrid Law, Jen Nadol (a fellow Tenner – I love The Mark!). I can’t begin to name them all.

Crossposted at: Zoe's Book Reviews

Win: Dirty Little Secrets by C. J. Omololu

2010-02-08T18:13:00.000-08:00

This week I am hosting the much awaited for Dirty Little Secrets Week! Starting off, I'm having a contest where I have 4 copies of Dirty Little Secrets to give away! 1 of those copies will include SWAG! *yes, I know... swag is amazing!*
In order to be entered to win one of the four copies, you must fill out the form below. *This contest is for US Residents only, sorry international readers!*

Everyone has secrets. Some are just bigger and dirtier than others.

For sixteen years, Lucy has kept her mother's hoarding a secret. She's had to -- nobody would understand the stacks of newspapers and mounds of garbage so high they touch the ceiling and the rotting smell that she's always worried would follow her out the house. After years of keeping people at a distance, she finally has a best friend and maybe even a boyfriend if she can play it right. As long as she can make them think she's normal.

When Lucy arrives home from a sleepover to find her mother dead under a stack of National Geographics, she starts to dial 911 in a panic, but pauses before she can connect. She barely notices the filth and trash anymore, but she knows the paramedics will. First the fire trucks, and then news cameras that will surely follow. No longer will they be remembered as the nice oncology nurse with the lovely children -- they'll turn into that garbage-hoarding freak family on Collier Avenue.

With a normal life finally within reach, Lucy has only minutes to make a critical decision. How far will she go to keep the family secrets safe?

Loading...

Cross-posted at: Zoe's Book Reviews.

The Prince from the Wrong Side of the Tracks

2010-02-04T04:28:00.000-08:00

Well, this past week you have met Julie Kagawa the author of The Iron King and one of the main characters in the story, Puck. Now after some coaxing and promises made that I'd rather not speak of I am pleased to offer you an exclusive interview with Ash - the bad boy of The Iron King.

First off, please tell us a little about you.

My name is Ash, third prince of the Unseelie Court. That’s all you need to know about me.

What can you tell us about your role in The Iron King?

I’m there to protect Meghan and kill things, nothing more. And, perhaps I came to ... care for her ... a bit, but that is none of your business.

What was your favorite part or scene of the book? Or maybe is there a favorite line(s) you had that you want to share?

“I’ll kill you.”

Overall, how do you think the Julie Kagawa handled your story?

Adequately.

Which character in the story would you most like to have a drink with and why? Would you meet for coffee/tea or perhaps for a pint at the local pub? Is there any place in particular that you had in mind for this meeting? (For example: Harry Potter might meet with Ron Weasley over at the The Three Broomsticks for some Butterbeer because they are best mates. Or maybe Malfoy would lure Harry to The Hogs Head in order to slip something into his drink so Slytherin would win the upcoming quiddich match against Gryffindor)

If I could get Puck alone in a room with the door barred from the outside, that would make me very happy.

If you could meet any character from another book, who would it be and why?

I keep hearing things about this human, Valek. I would like to meet him in person someday, just to see who is the better warrior.

If you've enjoyed meeting Ash here, be sure to check out his full story in Julie Kagawa's The Iron King available now where ever books are sold.

Cross-posted at: Ticket To Anywhere .